Transcript asmbl_46486

Sequence
Transcript Sequence for observation asmbl_46486 of TGE0000421:
TTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGCTTCTCTACGCAGAACCCGGGAGTAGGAGACTCAGAATCGAATCTCTTCTCCCTCCCCTTCTTGTTTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAGAAAAAAAAAACCCTGGTTTTTTATTTTTGTATTTTATTATTGTTTACTTCAAACTTTGTTTTACAGCGTCCTCCACAAAACCTCTAGAATGCACTAGATATATTTTTCTTGGAGTCATAATCATGATGCATACCAACACAACACTACTCAAATTATATTTCATTGAGATGCATGTTGCATTGAGGAGTCAACTTGACATAGAGTGGAGACTTTTTCAAAATGGCTTTTACATCCTAATGAAAGTTTGGGAAGTATATCCTCTCTGCCTTTTCATCAGTGCTTTGTGGTCCAGCTGGCACCCTTTCTGAGGTTTGTGTTTTGTGCTAAATGGTTTTGTCCTTAAATAGGAGAGGCTCAAAAACATCAAGATTTCAGGAAAATGGCGACAGCTGCATAATGGAACCCCCCTGCTTCTATTTTGTTCTTTTAATTACTATTTATAGCCCCAGTTACCTTCTGAATTCTGAAGTGTATATACCTCCATGTTCCTGAAAACAAGAAAACTCTTACTTCCTGATATTCCATAGACTGCCTTCCCAGGTGATTGAGAACATAGAGAATGTTACACATTTATTTTACTCTAAATGATCTTTTACCCCTGTTAGCTAATCTTTGTGTTTTCCTCAACTTTATTAATTACAGTGATTGCATTTTTAGCATCCAGTTGTAAGATGAATATATTAAACAGCTACCAGTGTTGGTGATACCTCATCCTTGAAAGGCTTAGTTCATTTGTGTTTTATACTTCAGTTTTTCCAGCATAGCAGAAAATGCCGCTTATAATTTTTGTGCACACAAACCTTGGATTCCCCTGTAAAGTTGCTATTGTTTCATAGCATGCGGCACTGGCCTTTTTTCATCCTACTCATTACAGGCAAAACTCATGTCTTATTTATGAGGATTTTATAGATCATTTTCTGTAACAGGTGACAAAAGCAGAAAAGAATGAAGAGGCTGAAGTATGAACTACCCTTGGAGCCCATATACATGATATAGGCAATTTCTTTTGTATGTTAATTCAGTCAAAAATACTACCCACTTGATGTTTTCTAATCTGATGTGAGCTCATGTTACACAGACTTTTAGTAAGTAACCCGTGACTAGAAAATAAACTGGATGCTTAGGAGAGAGTGTCAGATGTATAAGATGCTAATAAAACCTGTTTAATATTATTGTTAGCTGTAAGTTTTTGGGAAATACTGAACAAATTAGTCCACAATCAAGTGTCTACTTTTCCCTTCACTGTAGGGCCTCTCCCTGCACAGAGCAGTCTGTTTAGCTGTGAACACCACAATCTGCAGATGTTCAAGTCCCTTACATAAAATGGCATAGTATTTATATGTAACCTATGCATATTCTCCTGTATATTTTAAATCATCTCTACATTAAAATACCTGATAAAATGTAAATGGTATGTAAATAGTTGTAACTTTTTTTATTTATATTTTTGTTAA