Transcript asmbl_32735

Sequence
Transcript Sequence for observation asmbl_32735 of TGE0004893:
GCGTCGGATCAGGCGCTGCGTGGACAGCCGCACGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGTGCTCCTTCCCTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCCAAAAATAGGTTGTGTCTTATTTTCTTTACCACAGAGATATATGCTTTACCAATTTTAGGAGATTTGGAAAATATTTGATTCAGAGTTCTCTAGAGTAAATGCGATTCACAGTAAAGTTTATCCCCTGCATGTAATAAAATAACAGTAAATCTAGAAGAAATAAATGTACAGCATTCTTGTAAAGAGGACTTAACACTGAATTTCTAGCAGTATCATCTTAGGAATTCTTGATAATGCACATTCTTAGATTCATCTTCCTGGGGACTCAGTATAATAAATACTATCAAGTTCCTTGCTCTTGGTTTTTGAGTATCTAAAT