Transcript asmbl_45556

Sequence
Transcript Sequence for observation asmbl_45556 of TGE0000365:
CACGTGGGGGCTCAGCGTGCACCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAACGGCAAGCTTGAGTCAGGACCCTTAATTAAGATCCTCAATTGGCTGGAGGGCAGATCTCGCGAGTAGGGCAACGCGGTAAAAATATTGCTTCGGTGGGTGACGCGGTACAGCTGCCCAAGGGCGTTCGTAACGGGAATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCCAAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAGGACCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGCCACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTACCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAATGTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAGATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTCCTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTTTTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAAATAAAGAGCCATAGTTTCAGCCTT