Transcript asmbl_38559

Sequence
Transcript Sequence for observation asmbl_38559 of TGE0056198:
CCTGAGACCCTAGCTCTGCTCTCGGTCCGCTCGCTGTCCGCTAGCCCGCTGCGATGTTGCGCGCTGCCGCCCGCTTCGGGCCCCGCCTGGGCCGCCGCCTCTTGTCAGCCGCCGCCACCCAGGCCGTGCCTGCCCCCAACCAGCAGCCCGAGGTCTTCTGCAACCAGATTTTCATAAACAATGAATGGCACGATGCCGTCAGCAGGAAAACATTCCCCACCGTCAATCCGTCCACTGGAGAGGTCATCTGTCAGGTAGCTGAAGGGGACAAGGAAGATGTGGACAAGGCAGTGAAGGCCGCCCGGGCCGCCTTCCAGCTGGGCTCACCTTGGCGCCGCATGGACGCATCACACAGGGGCCGGCTGCTGAACCGCCTGGCCGATCTGATCGAGCGGGACCGGACCTACCTGGCGGCCTTGGAGACCCTGGACAATGGCAAGCCCTATGTCATCTCCTACCTGGTGGATTTGGACATGGTCCTCAAATGTCTCCGGTATTATGCCGGCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACACACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCGTGGAATTTCCCGCTCCTGATGCAAGCATGGAAGCTGGGCCCAGCCTTGGCAACTGGAAACGTGGTTGTGATGAAGGTAGCTGAGCAGACACCCCTCACCGCCCTCTATGTGGCCAACCTGATCAAGGAGGCTGGCTTTCCCCCTGGTGTGGTCAACATTGTGCCTGGATTTGGCCCCACGGCTGGGGCCGCCATTGCCTCCCATGAGGATGTGGACAAAGTGGCATTCACAGGCTCCACTGAGATTGGCCGCGTAATCCAGGTTGCTGCTGGGAGCAGCAACCTCAAGAGAGTGACCTTGGAGCTGGGGGGGAAGAGCCCCAACATCATCATGTCAGATGCCGATATGGATTGGGCCGTGGAACAGGCCCACTTCGCCCTGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTCGTGCAGGAGGACATCTATGATGAGTTTGTGGAGCGGAGCGTTGCCCGGGCCAAGTCTCGGGTGGTCGGGAACCCCTTTGATAGCAAGACCGAGCAGGGGCCGCAGGTGGATGAAACTCAGTTTAAGAAGATCCTCGGCTACATCAACACGGGGAAGCAAGAGGGGGCGAAGCTGCTGTGTGGTGGGGGCATTGCTGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAGTTCAGCAAGATCAGCAACAAAACCAAGAAAAATGATCCTTGCGTGCTGAATATCTGAAAAGAGAAATTTTTCCTACAAAATCTCTTGGGTCAAGAAAGTTCTAGAATTTGAATTGATAAACATGGTGGGTTGGCTGAGGGTAAGAGTATATGAGGAACCTTTTAAACGACAACAATACTGCTAGCTTTCAGGATGATTTTTAAAAAATAGATTCAAATGTGTTATCCTCTCTCTGAAACGCTTCCTATAACTCGAGTTTATAGGGGAAGAAAAAGCTATTGTTTACAATTATATCACCATTAAGGCAACTGCTACACCCTGCTTTGTATTCTGGGCTAAGATTCATTAAAAACTAGCTGCTCTTAACTTACT