Transcript asmbl_37963

Sequence
Transcript Sequence for observation asmbl_37963 of TGE0058164:
GGGGAAGGGGACAGGGTTGAGAGCTTTACAGAGGAAGTGGACAGCATGGAGGGAGGTAAGGAAAGGCCTGTAAAGAGGAGGAGACACTGGCTCTGGCGGAATGGGGACTATTGGAGGGTTAAGCGGATGTGGCTAAGGCTGAGTCATCTAGGAGTAAACAAGAGGCCTTCCTTTGGGAGGAGCCAATCCAGGGTGTAGGGGGCCCAGAGTGACCAGGTGCACTAGGGAAAAAATGCCAGGAGAGGGCCAGGAAGAGGACTTGTTAGTAGCGACTCACTTCTGGGCAGGCAGGCCAGCCAGCTAGCCAGCCTGCTGAGGCTTCCCAAGAGGGGCAGAGTGCTGGGATCTGGGAATCCAGGAAAGGAGGGAATGGGGTGGGGCTAGATGAAAAGGGATAGGTGTCCAGGGAGAGCCTCTGGCTATTCCTGGGACCAGGAAGTTTTCACTAGGATACATAACACTTTTTACACACTCACCCCACCCATCCCTGGCTTTCTATTCATGGAACAACCTCTCTCTACAATCCCTCCAGATCTTCGCAAATACTGTGGACAATGCCCGCATCGTTCTGCAGATTGACAATGCCCGTCTTGCTGCTGATGACTTTAGAGTCAAGTATGAGACAGAGCTGGCCATGCGCCAGTCTGTGGAGAACGACATCCATGGGCTCCGCAAGGTCATTGATGACACCAATATCACACGACTGCAGCTGGAGACAGAGATCGAGGCTCTCAAGGAGGAGCTGCTCTTCATGAAGAAGAACCACGAAGAGGAAGTAAAAGGCCTACAAGCCCAGATTGCCAGCTCTGGGTTGACCGTGGAGGTAGATGCCCCCAAATCTCAGGACCTCGCCAAGATCATGGCAGACATCCGGGCCCAATATGACGAGCTGGCTCGGAAGAACCGAGAGGAGCTAGACAAGTACTGGTCTCAGCAGATTGAGGAGAGCACCACAGTGGTCACCACACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGAGACCAATGACACCAAAGTTCTGAGGCATTAAGCCAGCAGAAGCAGGGTACCCTTTGGGGAGCAGGAGGCCAATAAAAAGTTCAGAGTTCA