Transcript asmbl_37093

Sequence
Transcript Sequence for observation asmbl_37093 of TGE0000191:
GTCTAAGGAGTCGGCGGCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGGCAGGGGGGGGACCCGCCGCGGCTGCTGCCACCGCCGCCACCACCGCCTCTGCTCGTGGCGTGGGAAAGGAGGTGTGAGTCCCGGGCGCGAGCCGGCGGCGGCGCCGCTGCGGGAGGGTCGGCGGTGGGAAGGCGATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCGTTTTGACACTGCCTAGTCGGGACTTGTAACATAGAGTATATAACCTTCATTTTTAAGACTGTAATGTGTACTGGTCAGCTTGCTCAGATAGATCTGTGTTTGTGGGGGCCCTTCCTTCCATTTTTGATTTAGTGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGACTCTTCACTCCAAAAAGAAAAGTGTTTTGTTTTTTAATTCTCTGTTCCTTTTGCAAACAATTTTAATGATGGTGTTAAAGCTGTACACCCCAGGACAGTTTATCCTGTCTGAGGAGTAAGTGTACAATTGATCTTTTTTAATTCAGTACAACCCATAATCATGTAAATGCTCATTTTCTTTAGGACATAAAGAGAGCCCTAGGGTGCTCTGAATCTGTACATGTTCTTGTCATAAAATGCATACTGTTGATACAAACCACTGTGAACATTTTTTATTTGAGAATTTTGTTTCAAAGGGATTGCTTTTTCCTCTCATTGTCTTGTTATGTACAAACTAGTTTTTATAGCTATCAACATTAGGAGTAACTTTCAACCTTGCCAGCATCACTGGTATGATGTATATTTAATTAAAGCACACTTTTCCCCGACCGTATACTTAAAATGACAAAGCCATTCTTTTAAATATTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAATTATGTTTTGACACACCCCTAAGTACAAGGTGGTATGGTTGTATACACATGCTGCCTTCTTGGGGATTCAAAAACAGGTTTTTGATTTTGAATAGCAATTAGTGATATAGTGCTGTTTAAGCTACTAACGATAAAAGGTAATAACATTTTATACAATTTCCATATAGTCTATTCATTAAGTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACATTCTTTATTCTGCGGTGAAGTTGAGGCTTATAAGTTAAAACAAAGGAACTAACTTACTGTCCACCAGTTTATACAGAACTCACAGTACCTATGACTTTTTTAAACTAAGATCTGTTAAAAAAGAAATCTGTTTCAACAGATGACCGTGTACAATACCGTGTGGTGAAAATGAATTCAGACTTATTAAATGATGAACTTGTTAAATCTTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTGAATAGATTTTCCTGAATAAATTGCTCTGGAAACCACACGGTTGCATT