Transcript asmbl_36441

Sequence
Transcript Sequence for observation asmbl_36441 of TGE0000137:
CAGAAAATGGAGCCATTGCTTACGCGAATCGTTTGAGGGAAGGGGCGGGAGTTGGGGAGGTGGAGTTCCCTGTTAAAACGGGCCACTTGATTAGCAAAGTGGTAGCTGTTATTTTGGGGGAATTCCCGTCTTGATTGCATTAAGGCGGGTCTCCATCTTTCCAGGCCAGGAGGAATGTGGTGGTGGAGGTGGAGGATTGTGGTATGTGGTCAGGAGTGAGAAGAAATAGTAAGGCCGTCCCGGTGAGGGAGAAATGTAACCTAAAACCTGTCTCTGCTGTTGTTGGATTGGGTCACCCCTGGTCTATGGCATGAAAGTTTTATTGGGAGGAGATCTGCTGCAAGAGTCTGATTGCTTGGGTCAGTGCAACAGGACAGAATCTAGTCGCTGCATACCTCCTTCCCTGTCCTCAATCAGGATCAAGTCTTCCATACCAGGGACCAGGCCAAAACCAGACTGCCACTGCCCCTACTTGGGCCCCACTGTCCCCAGAAAGCAGCTGCTGTGATCATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTCGGGGAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAACATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTAAATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTACTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACAGACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAAAGCCAGACAGCCCTAACAAAGCACCCCACCCACCCCTGACATACCTACTGTCACCCTGCCCCAGTCCTACCCCTTCCTCTCCATGCAAGTGTGGCCAGGGCCCTGGGTATCATGTCCACATGCCCAGCAAGAGCCTTGCCTCCCCTGCCTCCCCTCCTTTTTCCTGTCCACCTATATGACCAATCCCTAATTGCTGTCCTGATGATGAGTCATTCCAATTTACTGGATTTAAAACAAAAAGTTGTTACGGTTTCATGGGGTGGCCCCTCTCTCTCTCACCCTCTGGGTTTCGGGAGGTCGAGTGGGGTATTCTCTTTGTTTGGCAGTGGTTGCTGTCCTCTTGGCATCTGAGTCCTTTCCCTGTCCCCACAAGCCCTTCTACTCCCTGTTTGCCTTTCCTTTGCCACCCTCTCCCTGTTTTACATGGAAATTGCACGGGCCTCTCTGTGTTTGCGTGCATGTGTGCGCCTGTATATACATGTATAGAGAGATATATTTGTGGGGGCCGGGGGGAGCGGGGAGGGGGTGGAGTGAAGCTCAGGGCTTGCAGCCAGGACACTGCCCACTGGAGCCTGTCATCTGCCCCTTCCGTGTTGGTGAGATTAAGGGAAGAAGGTGGGAGGGCATTAGTCAAGCCGGACTGCCCCAGTCTTTGACTGGTTACCCTCCTCTCTGCAGGTAGGTTTTTCTGGATGATAGGACAGATGATGGATTCTTCACCACCATTTTCCTTGTACTCTTCTCTCCACCCTTCTTAGGGCTGGAGGATGGCATTTATCTCTAGATGACTGTTCCCAAGGAGATGCCACTCTGCTCTGCCTTACTGTTGGGAAGGAGAGAGGAACCCACTCACTCTTATCAGCTTAGAGTGTTCAACTGATCCTTCCCCACCATCTTCAGATCTGTTCCTCTGGAGCTTGACTGGGGGGTGGGGATGGCAAGTCCATGGTGTGTGTTAGGGACCCAGGGCATTGGGGGAAGGGAGGCGAAGGCCTGAGGTTTTCCATCTTCATTCTCTTTTGTTATTAGGAGAAGGTGAGGCATGGGCCAATCCCATTCCTGCCTTCCAGTGCCCCACCACCCTTCTGATCTTAGGGGTTGGATGGGTCATCTGTCCTTGGTCAGAATTTTCTCACCCTAGTACTCCTACTGGCCTGACCAGGGCTGACTGGGTATTCTAATGAGGAGCTGGGAAGTGGGGTGACATAGCTGACCTTAGTATCAACCCCCCTCTTCTCCAACTCTTGTTTTCTAGTCCAGGATATGCTAAAGGACGAAGATTTTCTATTGTTTCCAGGCCCTCAGACCATCCTTGCTGTCCCTTCACCCTCCATGCCCCTGCCATCCTCACTCACTTCTCATAAATGGATCTGGGGGTTAGAGTGGAGGAAATAAAATCCTGAAGTGGTTGTCAGTGCTTGTGGGATGCAGTGGTCTTCAGGATTCTCCCCGCATTATTATGTAGTTGTTCAGAAGCTGTTGCTACTGCGTCTCTCTGTCTGCAGGGGGCACTTGTTCCTGAGGTCCTCGCCTGGGTCCTGACTTCTGTAGTTTCTGTGAAGACGTGGCTGTCCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCGAGACAGCTGCCCATAACCTGCTAAGGTCAGGGCCCAGGGCCCCCCACAGCATGGCTGAGGGACCCCTTCCCAGTAGGGCTGTCCCAAGCCCCACTCCATGGGGCCAGGTTTCCTGGCCACTTTTGTTGATAGCAGATGGATCAATATTAGTAACCCCATCCAAGATTGAACTGTGAAAGAGAGGTTCCAGGGGTATCTCCCTCAGTGCCAGTTACTTAGTGATGTGTTACCCAGGATGCAGCAGGTGTGTGCAGGTATCTTGCTCTCTAGGCCTGTGTGTGTGTGTGAGTGTGTGTG