Transcript asmbl_36440

Sequence
Transcript Sequence for observation asmbl_36440 of TGE0000137:
CCGGGCTGGGGGTGGGGGTACGCCGCACAGCTCCAGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCAGGGCAGCAGCCGGGCTGAAGTCGGCTTGGGGAGCCAGAGGGAGCGGAGCGGAACCTGCGGGGCAGAGGCGGCGGCCGCAGCGGCGCAGCTGATAGCAGGAACAGGATCAAGTCTTCCATACCAGGGACCAGGCCAAAACCAGACTGCCACTGCCCCTACTTGGGCCCCACTGTCCCCAGAAAGCAGCTGCTGTGATCATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTCGGGGAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAACATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTAAATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTACTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACAGACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAAAGCCAGACAGCCCTAACAAAGCACCCCACCCACCCCTGACATACCTACTGTCACCCTGCCCCAGTCCTACCCCTTCCTCTCCATGCAAGTGTGGCCAGGGCCCTGGGTATCATGTCCACATGCCCAGCAAGAGCCTTGCCTCCCCTGCCTCCCCTCCTTTTTCCTGTCCACCTATATGACCAATCCCTAATTGCTGTCCTGATGATGAGTCATTCCAATTTACTGGATTTAAAACAAAAAGTTGTTACGGTTTCATGGGGTGGCCCCTCTCTCTCTCACCCTCTGGGTTTCGGGAGGTCGAGTGGGGTATTCTCTTTGTTTGGCAGTGGTTGCTGTCCTCTTGGCATCTGAGTCCTTTCCCTGTCCCCACAAGCCCTTCTACTCCCTGTTTGCCTTTCCTTTGCCACCCTCTCCCTGTTTTACATGGAAATTGCACGGGCCTCTCTGTGTTTGCGTGCATGTGTGCGCCTGTATATACATGTATAGAGAGATATATTTGTGGGGGCCGGGGGGAGCGGGGAGGGGGTGGAGTGAAGCTCAGGGCTTGCAGCCAGGACACTGCCCACTGGAGCCTGTCATCTGCCCCTTCCGTGTTGGTGAGATTAAGGGAAGAAGGTGGGAGGGCATTAGTCAAGCCGGACTGCCCCAGTCTTTGACTGGTTACCCTCCTCTCTGCAGGTAGGTTTTTCTGGATGATAGGACAGATGATGGATTCTTCACCACCATTTTCCTTGTACTCTTCTCTCCACCCTTCTTAGGGCTGGAGGATGGCATTTATCTCTAGATGACTGTTCCCAAGGAGATGCCACTCTGCTCTGCCTTACTGTTGGGAAGGAGAGAGGAACCCACTCACTCTTATCAGCTTAGAGTGTTCAACTGATCCTTCCCCACCATCTTCAGATCTGTTCCTCTGGAGCTTGACTGGGGGGTGGGGATGGCAAGTCCATGGTGTGTGTTAGGGACCCAGGGCATTGGGGGAAGGGAGGCGAAGGCCTGAGGTTTTCCATCTTCATTCTCTTTTGTTATTAGGAGAAGGTGAGGCATGGGCCAATCCCATTCCTGCCTTCCAGTGCCCCACCACCCTTCTGATCTTAGGGGTTGGATGGGTCATCTGTCCTTGGTCAGAATTTTCTCACCCTAGTACTCCTACTGGCCTGACCAGGGCTGACTGGGTATTCTAATGAGGAGCTGGGAAGTGGGGTGACATAGCTGACCTTAGTATCAACCCCCCTCTTCTCCAACTCTTGTTTTCTAGTCCAGGATATGCTAAAGGACGAAGATTTTCTATTGTTTCCAGGCCCTCAGACCATCCTTGCTGTCCCTTCACCCTCCATGCCCCTGCCATCCTCACTCACTTCTCATAAATGGATCTGGGGGTTAGAGTGGAGGAAATAAAATCCTGAAGTGGTTGTCAGTGCTTGTGGGATGCAGTGGTCTTCAGGATTCTCCCCGCATTATTATGTAGTTGTTCAGAAGCTGTTGCTACTGCGTCTCTCTGTCTGCAGGGGGCACTTGTTCCTGAGGTCCTCGCCTGGGTCCTGACTTCTGTAGTTTCTGTGAAGACGTGGCTGTCCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCGAGACAGCTGCCCATAACCTGCTAAGGTCAGGGCCCAGGGCCCCCCACAGCATGGCTGAGGGACCCCTTCCCAGTAGGGCTGTCCCAAGCCCCACTCCATGGGGCCAGGTTTCCTGGCCACTTTTGTTGATAGCAGATGGATCAATATTAGTAACCCCATCCAAGATTGAACTGTGAAAGAGAGGTTCCAGGGGTATCTCCCTCAGTGCCAGTTACTTAGTGATGTGTTACCCAGGATGCAGCAGGTGTGTGCAGGTATCTTGCTCTCTAGGCCTGTGTGTGTGTGTGAGTGTGTGTG