Transcript asmbl_30530

Sequence
Transcript Sequence for observation asmbl_30530 of TGE0000096:
TGGATTGACTGAAAGGAGTGGGGAAGCTTAGGGAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCCTCCACCCCCGTTCGCCTAAGCTCCCTTCTCCGGGAATTTCATCATTTCCTAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCATCTGTTCTAAAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCTTTGACTGGTCCCCAGTGGTGACCTATGTGTGTGATCTTGAAGGGAACAGAGTCAAGGGTCCAGAGAAGGAGGAGAAGTTGAGACAGGCGGTCAAGCAGGTGCTGAAGTGTGATGTGACTCAGAGCCAGCCACTGGGGGCCGTCCCCTTACCCCCGGCTGACTGCGTGCTCAGCACACTGTGTCTGGATGCCGCCTGCCCAGACCTCCCCACCTACTGCAGGGCGCTCAGGAACCTCGGCAGCCTACTGAAGCCAGGGGGCTTCCTGGTGATCATGGATGCGCTCAAGAGCAGCTACTACATGATTGGTGAGCAGAAGTTCTCCAGCCTCCCCCTGGGCCGGGAGGCAGTAGAGGCTGCTGTGAAAGAGGCTGGCTACACAATCGAATGGTTTGAGGTGATCTCGCAAAGTTATTCTTCCACCATGGCCAACAACGAAGGACTTTTCTCCCTGGTGGCGAGGAAGCTGAGCAGACCCCTGTGATGCCTGTGACCTCAATTAAAGCAATTCCTTTGACCTGTCCAGTTGACTTTAGTCCTTGTTTCTAACTGCCAAGTCATGTGCTGAGTAGAGGCTCAGTGGTTGGGGCCCAATGGTTCATCTAGGACGGGACTAGAGAGGTCAGTCTACAAGCAATCCATTGACCACTTACTTGGTGCTGCACACAAATGTTGGTGCTATGGGACCCAAAGATGAGCAATTAGTATTCCAGTCTTCATTGCCTGTGCTTACAAAAGAAGACCTCACTTCCCTAAACATCTAGTTATGGCGGCTCAAGCCCGTACCTGCCTACAGAGAAGTGTCTGCAGTTACTCACTATTAGTTTCCTAAGGGGGCACTGCTGGCTCCTTCTCTCCCAGGAATGGGCTTCTCCTATTCTTTAACTCTTGCCTTCTCCCTGGAGAGGCTACCAAACCCTGGCCTCTGCCGCTGTTCAGGCTGCCATGTGGGTATAGCTGTTTGCTAGACTCCACTCTGGCCTCAGGGGCCAGAGAACAGCTGTCCAGCATTTCTGTTCATCCCAGCAATCCAAAAAAAAATTTTTTTAAGCTACAAAGATCACTCCATTTTCAAATTCAGACTCTGCCACTTATTAGCTGTTTCTCATTAGGCAAGTTATATAACCTTGCAGTGCCTCACTTTCCTCATCTATAAAATGAGATTAAAATAGTCTTTTTATTAAGAGAATTAAAGTGAATTGTGGCCAGGCACTGTGGCTCATGCCTGTAATCCCA