Transcript asmbl_23649

Sequence
Transcript Sequence for observation asmbl_23649 of TGE0003481:
GCCGAGCGGCCATATTGCGGAGCTGTCTGCGGTGGCGGCGGCGCCTCTCGTCTCCCGCGGGCCAGCGCTCGCACCACCGCTTCTCCCTCCCTGTCGCAGCCGCGCCGCCGCGCAGCGCCCCAGCCACACGCCGGCGGGCAGAAGCCGCCCGCTCTCCGGAAAGTGATAACAGAATTCATTGAAGTGGAGAATTTTTAAAGAAGGTAACAAAAAGAGAAAGAAAATGCCGAAACCAATCAACGTAAGAGTAACTACAATGGATGCTGAGCTGGAATTTGCCATTCAGCCCAATACAACTGGCAAACAACTTTTTGACCAGGTGGTGAAAACAGTTGGTTTGCGTGAGGTCTGGTTTTTTGGGCTGCAGTATGTAGACAGCAAAGGTTATTCTACATGGCTTAAACTAAATAAAAAGGTAACACAGCAGGATGTTAAAAAAGAGAATCCTTTACAGTTCAAGTTTAGAGCTAAATTCTTTCCTGAAGATGTTTCTGAGGAATTAATTCAAGAAATAACCCAGAGACTCTTCTTCTTGCAAGTTAAAGAAGCCATCTTAAATGATGAGATATATTGCCCGCCAGAAACTGCAGTTCTTTTGGCTTCCTATGCTGTCCAAGCCAAGTATGGAGATTACAATAAAGAGATTCATAAGCCAGGCTACCTGGCTAATGATAGACTCCTACCCCAGCGTGTATTGGAACAACACAAACTAACAAAAGAACAGTGGGAAGAAAGAATACAGAACTGGCATGAAGAACATAGAGGAATGTTAAGGGAGGATTCTATGATGGAATACCTGAAGATTGCACAAGATCTAGAAATGTATGGAGTCAACTATTTTGAAATAAAAAATAAAAAAGGAACTGAATTGTGGCTAGGTGTTGATGCTTTGGGTCTGAATATTTATGAGCATGACGACAAGTTAACACCTAAAATTGGTTTTCCCTGGAGTGAAATCAGAAATATTTCATTTAATGACAAAAAATTTGTTATAAAGCCAATCGACAAAAAGGCACCTGATTTTGTGTTTTATGCACCTCGTCTGAGAATCAATAAGCGGATTTTGGCCTTATGTATGGGAAACCATGAACTATACATGCGAAGAAGGAAGCCTGATACTATTGAAGTACAACAGATGAAGGCTCAGGCTAGGGAGGAGAAACATCAGAAGCAGTTGGAAAGGGCACAATTAGAGAATGAAAAGAAGAAAAGAGAAATAGCAGAAAAGGAAAAGGAAAGAATAGAACGTGAAAAGGAAGAGCTAATGGAACGTCTAAAACAAATTGAAGAGCAGACAATTAAAGCTCAGAAAGAACTAGAAGAACAGACTCGAAAAGCTCTAGAACTGGATCAAGAACGAAAACGAGCAAAAGAAGAAGCAGAACGACTTGAAAAGGAGCGTCGAGCTGCTGAAGAGGCAAAGTCTGCCATAGCAAAACAAGCTGCCGACCAGATGAAGAATCAGGAGCAGCTAGCAGCAGAACTTGCTGAATTCACTGCCAAGATTGCACTTCTAGAGGAAGCCAAGAAGAAAAAGGAAGAGGAAGCTACTGAGTGGCAACACAAAGCTTTTGCAGCCCAGGAAGACTTGGAAAAGACCAAAGAAGAGTTAAAAACTGTGATGTCTGCCCCCCCTCCACCTCCACCACCACCAGTCATTCCTCCAACAGAAAACGAACATGATGAACACGATGAGAATAATGCTGAAGCTAGTGCTGAATTATCAAATGAAGGGGTAATGAACCATAGAAGCGAGGAAGAACGTGTAACCGAAACACAGAAAAATGAGCGTGTTAAGAAGCAACTTCAGGCATTAAGTTCAGAATTAGCCCAAGCCAGAGATGAAACCAAGAAAACACAAAATGATGTTCTTCATGCTGAGAATGTTAAAGCAGGCCGTGATAAGTACAAGACTCTGCGACAGATTCGACAAGGCAATACAAAGCAGCGTATCGATGAGTTTGAAGCAATGTGAGAGCTGTTATTTTGCATATATGTTCTTCATAAGCTGAACCACCAACAGAGAAAAGCAGGCCTTTGCAGATATGATGGAATGCATCCCACCTTGCCAAAGCACTTACACCAGTTTGACTGTGCTAGCTAAAAGACAAATTTAAGGGGAGCTCTTCAACATTAAGGCAGTATGATATCATGCTTGGTTTTCTTTTTTCTTTTGGTCCAGGGAATGGAGAATGGTGTTCCATTGCCTCTTTTCACATTTTTTTTCTTTTTCTTTTTTTTT