Transcript asmbl_17400

Sequence
Transcript Sequence for observation asmbl_17400 of TGE0003332:
CTCACGCCGACCCAGGGGCCTAGGCCGCGGCGGCCAAGCCGGAGGCCCGCGCCGGACTCGGAGTCGGCCCTGGCTTCCTAAGATGGCCGCGCTGCCCCGCGGCCCCTCGCCCCTCTCTGCCCGGGATCTCCCTTTGGCCCTTTGACCCCAGCTTACCGCACTTCTTGTCCCTCCCGCAGATTCCCCTCTTCCCGCGGCCTCGCCATGGCGACCCACGGACAGACTTGCGCGCGTCCAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAATCCAGCTGAAAGAAACCTTTGGGAATGGATATCAGAAGATTTGGCCTTAATATATTTCCATTGTGACCAGCAGCAGGCTTTTTTCCCCCAAGAAGATGATCAAAACAAAGGATGATCTCAACAAGAGCTGTATTTTAAGTATTTAGACAGTTCTTTGTTAGCTGGTTTCTAGTTGGTTATCTAGTTACCAATGCTGCAGTCCTGCAGTCACCTATACATTATTTAAATGTATTTAACTGTTAAATGCGCTACCCACCAATAATGAAATAGACCTTTATGAAAACTGTGCAATTGTGTGCATGTTTGTTTTTATGTTCCTTTAGAAAACATTGACTGTTACCATTGAATGAGATGGATCAGTGGATATTAAGATGAGGTTACAAATTTTGTTAAGTTCAGCCATTATTACTTTTGGTATCCCAGA