Transcript asmbl_162985

Sequence
Transcript Sequence for observation asmbl_162985 of TGE0059598:
GGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTGGTTCTCACACCTTTTAGGTCTGTTCTCGTCTTCCGTTCCGACTCTCTCTTTTTCGTTGCAGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCCGTTGTTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTGGAAGAGCCCCTGCACTGGTTGGCTCTGCGGACTCCGCGTCCGTCTGTGACACCCCCTGCACACTTACCCAATCCTTTTAGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAGCCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGCTCCAAACAGGCATGCGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCGCCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCCCAGTCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAGGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCACCTA