Transcript asmbl_158932

Sequence
Transcript Sequence for observation asmbl_158932 of TGE0056984:
CCTAGGGGAAGGGGGAGCCCACAAGGTCCGAGCTGGGGGCCCTGGCCTGGAGAGAGCTGAAGCTGGAGTGCCAGCCGAATTCAGTATCTGGACCCGGGAAGCTGGTGCTGGAGGCCTGGCCATTGCTGTCGAGGGCCCCAGCAAGGCTGAGATCTCTTTTGAGGACCGCAAGGACGGCTCCTGTGGTGTGGCTTATGTGGTCCAGGAGCCAGGTGACTACGAAGTCTCAGTCAAGTTCAACGAGGAACACATTCCCGACAGCCCCTTCGTGGTGCCTGTGGCTTCTCCGTCTGGCGACGCCCGCCGCCTCACTGTTTCTAGCCTTCAGGTGAGGCACCGAGAGAAACCGCCCACCTGGGGCTCCTGGGCCCGGACAGACCAGAGCCACCGCAGAGACCAGGCCTTGGCCCTGTGTTCAGTGACCCCCCTGGCCCAGCTCTGGGTTCCAGGCCTCTGCTCTGGCCGGGTGCAGCCCACGCTTGGGGTCGGCAGGAAATATCCTGCCCACCACGTGGAGTTTTTCTCGTGTCTCAGGTCTAAAGGCTTTGAACAGAAGCCTGTGCCCCTTGAGCACCAGGGCTGCGGTTTAAAGAGGGACAGCCTGCCAAGGCTGGGTGCTGCCCACAGGGTGGGGCAGCCCTCCCTTCCTGCCACCTGGGTGTGTGCGACGGCAGAGTGTGGGGGCAGGGGCGGGGATGTGCGCCTGTGGCTTGCTGCCCCTTGCAAATCAGTGGCTCTCCCTCTTTAAACCAAGTTGGACGCCAGATGGGTAAGTGCGACCCGCGGGCCTCTTGCTCCTGGGGCCTTTCCGTCCTCCCTTGCCCTGGCTCAAGCACCCCCATCTAACCATGTCTGCTGTGCTTCCAGGAGTCAGGGCTAAAGGTCAACCAGCCAGCCTCTTTTGCAGTCAGCCTGAACGGGGCCAAGGGGGCGATCGATGCCAAGGTGCACAGCCCCTCAGGAGCCCTGGAGGAGTGCTATGTCACAGAAATTGACCAAGGTGAGGCCCTGTCCCTGCCCGGCCGCCCTGCCCTGCTGGCTGGAAGCAGGCTGAGAGTACAAAAGGAAGGTACCGCTTCTGTAAGCAGCCAAGACGGGGCCCCAACTCCTGGGCCCCCTAAGCCAGGCAACCCTTTCCCAATTGGTGACCCAAGCCGCTGGGGATGTGGCTCGCCACCCACAGCTATTAGGAAGGCCTTCTACCCTGCAGTACCATGCCATCTCCACAGGGAAAGACTCAAAGTCCAGCCTCAGTGCTGCCCGGCCCTTCAGCCACGGCCATGGTACTTGTGCACAGGCCTGGGGCAGCCTTGTGGGTAGGAGGAGCCCAGTGGGCTTCATTTCACGGCCTAGTCCTGCCCTTCCCAGCTGCATGACCTGAAGCAAGTTCCTGCCCGTCTCTGAGCCTGTTAACATGCAGGGGATATGGTGTTCACGGTAACCTTTCTTAGGAGGCAGCAAGGCCTGGGTTTGGCTTGTAAAAGATTTCCGTCCCAATGCACCCTGACGGTGGGCAGCTTGAGTGTCTAAACCTTCGGCCCTCAGGAGGTCTGCTGCGGGGTGCAGGTGCCCAGCGTGGCTGGGCTCACACTGATGGACCGGCAAAATGGGGAGGGCCAGGGTTGAGGCTGTTCCTCACAGACACCATCTGCTGGTTTGAGGAGGGGCCCCAGGCCCACAGCATGACTCCCTGCTCCTCAGATAAGTATGCTGTGCGCTTCATCCCTCGGGAGAATGGCGTTTACCTGATTGACGTCAAGTTCAACGGCACCCACATCCCTGGAAGCCCCTTCAAGATCCGAGTTGGGGAGCCTGGGCATGGAGGGGACCCAGGCTTGGTGTCTGCTTACGGAGCAGGTCTGGAAGGCGGTGTCACAGGGAACCCAGCTGAGTTCGTCGTGAACACGAGCAATGCGGGAGCTGGTGCCCTGTCGGTGACCATTGACGGCCCCTCCAAGGTGAAGATGGATTGCCAGGAGTGCCCTGAGGGCTACCGCGTCACCTATACCCCCATGGCACCTGGCAGCTACCTCATCTCCATCAAGTACGGCGGCCCCTACCACATTGGGGGCAGCCCCTTCAAGGCCAAAGTCACAGGCCCCCGTCTCGTCAGCAACCACAGCCTCCACGAGACATCATCAGTGTTTGTAGACTCTCTGACCAAGGCCACCTGTGCCCCCCAGCATGGGGCCCCGGGTCCTGGGCCTGCTGACGCCAGCAAGGTGGTGGCCAAGGGCCTGGGGCTGAGCAAGGCCTACGTAGGCCAGAAGAGCAGCTTCACAGTAGACTGCAGCAAAGCAGGCAACAACATGCTGCTGGTGGGGGTTCATGGCCCAAGGACCCCCTGCGAGGAGATCCTGGTGAAGCACGTGGGCAGCCGGCTCTACAGCGTGTCCTACCTGCTCAAGGACAAGGGGGAGTACACACTGGTGGTCAAATGGGGGGACGAGCACATCCCAGGCAGCCCCTACCGCGTTGTGGTGCCCTGAGTCTGGGGCCCGTGCCAGCCGGCAGCCCCCAAGCCTGCCCCGCTACCCAAGCAGCCCCGCCCTCTTCCCCTCAACCCCGGCCCAGGCCGCCCTGGCCGCCCGCCTGTCACTGCAGCCGCCCCTGCCCTGTGCCGTGCTGCGCTCACCTGCCTCCCCAGCCAGCCGCTGACCTCTCGGCTTTCACTTGGGCAGAGGGAGCCATTTGGTGGCGCTGCTTGTCTTCTTTGGTTCTGGGAGGGGTGAGGGATGGGGGTCCTGTACACAACCACCCACTAGTTCTCTTCTCCAGCCAAGAGGAATAAAGTTTTGCTTCCATT