Transcript asmbl_158881

Sequence
Transcript Sequence for observation asmbl_158881 of TGE0056115:
GAAGCCCCACCTGGAGGAGCGGCCGGGATGGGCCTCCGGGACGGTGTGCCAGGCCGGGGCCAAGTCGGAGGCCCCTCGCTCTGGGTGGGCGCTGGGGCCCGCGAGGGCTACTGTAAGGACCCCTGGCTTCTGAGGATACTGCGTCTAGAACTTTCTCCGTATGGGGCCTTGAGGTGCTTGGTCGAGACCTGCCTTTGCGCTTGGTCCCGAATCCTGCCCTCTAGGAGTCGCTCTTGCGGGCCTCCAGCCCACCGGAGGCGAAGCGGCCCCGGGCGGAAGGCCGCTGGATCCTCGAGGGAGGTGCCGGTTTCTCTCCGCGGGCGCCGTGGGGACGGTGGGAGGCGGGGGCGTCGGCAGCGCTTGGACTAGGTGCGGCCTTGGGCCTGCCTGGTAGCGGGGATTTGGGCCCGCAGAGCGCCCGCCTCTGCGGCTGAGTTCTGCCTGGCGGGGAAGGGAGCGCCCGATGGGTGCCGAGGCGTCCTCCTCTTGGTGCCCTGGCACTGCTCTTCCCGAAGAACGCCTTTCAGTTAAACGGGCGTCGGAAATCTCGGGCTTCCTGGGGCAGGGATCGTCGGGAGAGGCCGCTCTGGACGTGTTGACACACGTGCTGGAGGGGGCAGGAAACAAGCTCACATCTTCCTGTGGGAAACCTTCTAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTGCTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAGAACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAAAAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACCAAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCCATGGACAAGAAGGAAGAGTAAGGGCCTCCTTCCTCCCCTGCCTGCAGCTGGCTTCCACCTGGCACGTGCCTGCTGCTTCCTGAGAGCCCGGCCTCTCCCTCCAGTACTTCTGTTTGTGCCCTTCTGCTTCCCCCATTCCCTTCCACAGCTCATAGCTCGTCATCTCGGCCCTTGTCCACACTCTCCAAGCACATTACAGGGGACCTGATTGCTACACGTTCAGAATGCGTTTGCTGTCATCCTGCTTGGCCTGGCCAGGCCTGGCACAGCCTTGGCTTCCACGCCTGAGCGTGGAGAGCACGAGTTAGTTGTAGTCCGGCTTGCGGTGGGGCTGACTTCCTGTTGGTTTGAGCCCCTTTTTGTTTTGCCCTCTGGGTGTTTTCTTTGGTCCCGCAGGAGGGTGGGTGGAGCAGGTGGACTGGAGTTTCTCTTGAGGGCAATAAAAGTTGTCATGGTGTGT