Transcript asmbl_15311

Sequence
Transcript Sequence for observation asmbl_15311 of TGE0056448:
CCGCCCCCGCCGCCTCCTGGAGTCGCCGGGGCGGACGCGCAGTCCATGGGGCGCGGTGGGCCGGGGAGTTGCCCCAGGGGCCGCGGGAGTTGCTGAGAGGAGACAGGGTTGGGCTTTCTCCTCGCCCAGACCCCACCCCACCCTGCCGACCCCACCCCCTGCTCCTTCCTCCCCGGGGGCGCGCACTCGGGCACGCGCTCGGAAGTCGGGGGTCGGCGCGGAGTGCAGGCTGCTCCCGGGGTAGGTGAGGGAAGCGCGGAGGCGGCGCGCGGGGGCAGTGGTCGGCGAGCAGCGCGGTCCTCGCTAGGGGCGCCCACCCGTCAGTCTCTCCGGCGCGAGCCGCCGCCACCGCCCGCGCCGGAGTCAGGCCCCTGGGCCCCCAGGCTCAAGCAGCGAAGCGGCCTCCGGGGGACGCCGCTAGGCGAGAGGAACGCGCCGGTGCCCTTGCCTTCGCCGTGACCCAGCGTGCGGGCGGCGGGATGAGAGGGAGCCATCGGGCCGCGCCGGCCCTGCGGCCCCGGGGGCGGCTCTGGCCCGTGCTGGCCGTGCTGGCGGCGGCCGCCGCGGCGGGCTGTGCCCAGGCAGCCATGGACGAGTGCACGGACGAGGGCGGGCGGCCGCAGCGCTGCATGCCCGAGTTCGTCAACGCCGCCTTCAACGTGACTGTGGTGGCCACCAACACGTGTGGGACTCCGCCCGAGGAATACTGTGTGCAGACCGGGGTGACCGGGGTCACCAAGTCCTGTCACCTGTGCGACGCCGGGCAGCCCCACCTGCAGCACGGGGCAGCCTTCCTGACCGACTACAACAACCAGGCCGACACCACCTGGTGGCAAAGCCAGACCATGCTGGCCGGGGTGCAGTACCCCAGCTCCATCAACCTCACGCTGCACCTGGGAAAAGCTTTTGACATCACCTATGTGCGTCTCAAGTTCCACACCAGCCGCCCGGAGAGCTTTGCCATTTACAAGCGCACACGGGAAGACGGGCCCTGGATTCCTTACCAGTACTACAGTGGTTCCTGTGAGAACACCTACTCCAAGGCAAACCGCGGCTTCATCAGGACAGGAGGGGACGAGCAGCAGGCCTTGTGTACTGATGAATTCAGTGACATTTCTCCCCTCACTGGGGGCAACGTGGCCTTTTCTACCCTGGAAGGAAGGCCCAGCGCCTATAACTTTGACAATAGCCCTGTGCTGCAGGAATGGGTAACTGCCACTGACATCAGAGTAACTCTTAATCGCCTGAACACTTTTGGAGATGAAGTGTTTAACGATCCCAAAGTTCTCAAGTCCTATTATTATGCCATCTCTGATTTTGCTGTAGGTGGCAGATGTAAATGTAATGGACACGCAAGCGAGTGTATGAAGAACGAATTTGATAAGCTGGTGTGTAATTGCAAACATAACACATATGGAGTAGACTGTGAAAAGTGTCTTCCTTTCTTCAATGACCGGCCGTGGAGGAGGGCAACTGCGGAAAGTGCCAGTGAATGCCTGCCCTGTGATTGCAATGGTCGATCCCAGGAATGCTACTTCGACCCTGAACTCTATCGTTCCACTGGCCATGGGGGCCACTGTACCAACTGCCAGGATAACACAGATGGCGCCCACTGTGAGAGGTGCCGAGAGAACTTCTTCCGCCTTGGCAACAATGAAGCCTGCTCTTCATGCCACTGTAGTCCTGTGGGCTCTCTAAGCACACAGTGTGATAGTTACGGCAGATGCAGCTGTAAGCCAGGAGTGATGGGGGACAAATGTGACCGTTGCCAGCCTGGATTCCATTCTCTCACTGAAGCAGGATGCAGGCCATGCTCTTGTGATCCCTCTGGCAGCATAGATGAATGTAATATTGAAACAGGAAGATGTGTTTGCAAAGACAATGTCGAAGGCTTCAATTGTGAAAGATGCAAACCTGGATTTTTTAATCTGGAATCATCTAATCCTCGGGGTTGCACACCCTGCTTCTGCTTTGGGCATTCTTCTGTCTGTACAAACGCTGTTGGCTACAGTGTTTATTCTATCTCCTCTACCTTTCAGATTGATGAGGATGGGTGGCGTGCGGAACAGAGAGATGGCTCTGAAGCATCTCTCGAGTGGTCCTCTGAGAGGCAAGATATCGCCGTGATCTCAGACAGCTACTTTCCTCGGTACTTCATTGCTCCTGCAAAGTTCTTGGGCAAGCAGGTGTTGAGTTATGGTCAGAACCTCTCCTTCTCCTTTCGAGTGGACAGGCGAGATACTCGCCTCTCTGCAGAAGACCTTGTGCTTGAGGGAGCTGGCTTAAGAGTATCTGTACCCTTGATCGCTCAGGGCAATTCCTATCCAAGTGAGACCACTGTGAAGTATGTCTTCAGGCTCCATGAAGCAACAGATTACCCTTGGAGGCCTGCTCTTACCCCTTTTGAATTTCAGAAGCTCCTAAACAACTTGACCTCTATCAAGATACGTGGGACATACAGTGAGAGAAGTGCTGGATATTTGGATGATGTCACCCTGGCAAGTGCTCGTCCTGGGCCTGGAGTCCCTGCAACTTGGGTGGAGTCCTGCACCTGTCCTGTGGGATATGGAGGGCAGTTTTGTGAGATGTGCCTCTCAGGTTACAGAAGAGAAACTCCTAATCTTGGACCATACAGTCCATGTGTGCTTTGCGCCTGCAATGGACACAGCGAGACCTGTGATCCTGAGACAGGTGTTTGTAACTGCAGAGACAATACGGCTGGCCCGCACTGTGAGAAGTGCAGTGATGGGTACTATGGAGATTCAACTGCAGGCACCTCCTCCGATTGCCAACCCTGTCCGTGTCCTGGAGGTTCAAGTTGTGCTGTTGTTCCCAAGACAAAGGAGGTGGTGTGCACCAACTGTCCTACTGGCACCACTGGTAAGAGATGTGAGCTCTGTGATGATGGCTACTTTGGAGACCCCCTGGGTAGAAACGGCCCTGTGAGACTTTGCCGCCTGTGCCAGTGCAGTGACAACATCGATCCCAATGCAGTTGGAAATTGCAATCGCTTGACGGGAGAATGCCTGAAGTGCATCTATAACACTGCTGGCTTCTATTGTGACCGGTGCAAAGACGGATTTTTTGGAAATCCCCTGGCTCCCAATCCAGCAGACAAATGCAAAGCCTGCAATTGCAATCTGTATGGGACCATGAAGCAGCAGAGCAGCTGTAACCCCGTGACGGGGCAGTGTGAATGTTTGCCTCACGTGACTGGCCAGGACTGTGGTGCTTGTGACCCTGGATTCTACAATCTGCAGAGTGGGCAAGGCTGTGAGAGGTGTGACTGCCATGCCTTGGGCTCCACCAATGGGCAGTGTGACATCCGCACCGGCCAGTGTGAGTGCCAGCCCGGCATCACTGGTCAGCACTGTGAGCGCTGTGAGGTCAACCACTTTGGGTTTGGACCTGAAGGCTGCAAACCCTGTGACTGTCATCCTGAGGGATCTCTTTCACTTCAGTGCAAAGATGATGGTCGCTGTGAATGCAGAGAAGGCTTTGTGGGAAATCGCTGTGACCAGTGTGAAGAAAACTATTTCTACAATCGGTCTTGGCCTGGCTGCCAGGAATGTCCAGCTTGTTACCGGCTGGTAAAGGATAAGGTTGCTGATCATAGAGTGAAGCTCCAGGAATTAGAGAGTCTCATAGCAAACCTTGGAACTGGGGATGAGATGGTGACAGATCAAGCCTTCGAGGATAGACTAAAGGAAGCAGAGAGGGAAGTTATGGACCTCCTTCGTGAGGCCCAGGATGTCAAAGATGTTGACCAGAATTTGATGGATCGCCTACAGAGAGTGAATAACACTCTGTCCAGCCAAATTAGCCGTTTACAGAATATCCGGAATACCATTGAAGAGACTGGAAACTTGGCTGAACAAGCGCGTGCCCATGTAGAGAACACAGAGCGGTTGATTGAAATCGCATCCAGAGAACTTGAGAAAGCAAAAGTCGCTGCTGCCAATGTGTCAGTCACTCAGCCAGAATCTACAGGGGACCCAAACAACATGACTCTTTTGGCAGAAGAGGCTCGAAAGCTTGCTGAACGTCATAAACAGGAAGCTGATGACATTGTTCGAGTGGCAAAGACAGCCAATGATACGTCAACTGAGGCATACAACCTGCTTCTGAGGACACTGGCAGGAGAAAATCAAACAGCATTTGAGATTGAAGAGCTTAATAGGAAGTATGAACAAGCGAAGAACATCTCACAGGATCTGGAAAAACAAGCTGCCCGAGTACATGAGGAGGCCAAAAGGGCCGGTGACAAAGCTGTGGAGATCTATGCCAGCGTGGCTCAGCTGAGCCCTTTGGACTCTGAGACACTGGAGAATGAAGCAAATAACATAAAGATGGAAGCTGAGAATCTGGAACAACTGATTGACCAGAAATTAAAAGATTATGAGGACCTCAGAGAAGATATGAGAGGGAAGGAACTTGAAGTCAAGAACCTTCTGGAGAAAGGCAAGACTGAACAGCAGACCGCAGACCAACTCCTAGCCCGAGCTGATGCTGCCAAGGCCCTCGCTGAAGAAGCTGCAAAGAAGGGACGGGATACCTTACAAGAAGCTAATGACATTCTCAACAACCTGAAAGATTTTGATAGGCGTGTGAACGATAACAAGACGGCCGCAGAGGAGGCACTAAGGAAGATTCCTGCCATCAACCAGACCATCACTGAAGCCAATGAAAAGACCAGAGAAGCCCAGCAGGCCCTGGGCAGTGCTGCGGCGGATGCCACAGAGGCCAAGAACAAGGCCCATGAGGCGGAGAGGATCGCGAGCGCTGTCCAAAAGAATGCCACCAGCACCAAGGCAGAAGCTGAAAGAACTTTTGCAGAAGTTACAGATCTGGATAATGAGGTGAACAATATGTTGAAGCAACTGCAGGAAGCAGAAAAAGAGCTAAAGAGAAAACAAGATGACGCTGACCAGGACATGATGATGGCAGGGATGGCTTCACAGGCTGCTCAAGAAGCCGAGATCAATGCCAGAAAAGCCAAAAACTCTGTTACTAGCCTCCTCAGCATTATTAATGACCTCTTGGAGCAGCTGGGGCAGCTGGATACAGTGGACCTGAATAAGCTAAACGAGATTGAAGGCACCCTAAACAAAGCCAAAGATGAAATGAAGGTCAGCGATCTTGATAGGAAAGTGTCTGACCTGGAGAATGAAGCCAAGAAGCAGGAGGCTGCCATCATGGACTATAACCGAGATATCGAGGAGATCATGAAGGACATTCGCAATCTGGAGGACATCAGGAAGACCTTACCATCTGGCTGCTTCAACACCCCGTCCATTGAAAAGCCCTAGTGTCTTTAGGGCTGGAAGGCAGCATCCCTCTGACAGGGGGGCAGTTGTGAGGCCACAGAGTGCCTTGACACAAAGATTACATTTTTCAGACCCCCACTCCTCTGCTGCTGTCCATGACTGTCCTTTTGAACCAGGAAAAGTCACAGAGTTTAAAGAGAAGCAAATTAAACATCCTGAATCGGGAACAAAGGGTTTTATCTAATAAAGTGTCTCTTCCATTCACGTTGCTACCTTACCCACACTTTCCCTTCTGATTTGCGTGAGGACGTGGCATCCTACGTTACTGTACAGTGGCATAAGCACATCGTGTGAGCCCATGTATGCTGGGGTAGAGCAAGTAGCCCTCCCCTGTCTCATCGATACCAGCAGAACCTCCTCAGTCTCAGTACTCTTGTTTCTATGAAGGAAAAGTTTGGCTACTAACAGTAGCATTGTGATGGCCAGTATATCCAGTCCATGGATAAAGAAAATGCATCTGCATCTCCTACCCCTCTTCCTTCTAAGCAAAAGGAAATAAACATCCTGTGCCAAAGGTATTGGTCATTTAGAATGTCGGTAGCCATCCATCAGTGCTTTTAGTTATTATGAGTGTAGGACACTGAGCCATCCGTGGGTCAGGATGCAATTATTTATAAAAGTCTCCAGGTGAACATGGCTGAAGATTTTTCTAGTATATTAATAATTGACTAGGAAGATGAACTTTTTTTCAGATCTTTGGGCAGCTGATAATTTAAATCTGGATGGGCAGCTTGCACTCACCAATAGACCAAAAGACATCTTTTGATATTCTTATAAATGGAACTTACACAGAAGAAATAGGGATATGATAACCACTAAAATTTTGTTTTCAAAATCAAACTAATTCTTACAGCTTTTTTATTAGTTAGTCTTGGAACTAGTGTTAAGTATCTGGCAGAGAACAGTTAATCCCTAAGGTCTTGACAAAACAGAAGAAAAACAAGCCTCCTCGTCCTAGTCTTTTCTAGCAAAGGGATAAAACTTAGATGGCAGCTTGTACTGTCAGAATCCCGTGTATCCATTTGTTCTTCTGTTGGAGAGATGAGACATTTGACCCTTAGCTCCAGTTTTCTTCTGATGTTTCCATCTTCCAGAATCCCTCAAAAAACATTGTTTGCCAAATCCTGGTGGCAAATACTTGCACTCAGTATTTCACACAGCTGCCAACGCTATCGAGTTCCTGCACTTTGTGATTTAAATCCACTCTAAACCTTCCCTCTAAGTGTAGAGGGAAGACCCTTACGTGGAGTTTCCTAGTGGGCTTCTCAACTTTTGATCCTCAGCTCTGTGGTTTTAAGACCACAGTGTGACAGTTCCCTGCCACACACCCCCTTCCTCCTACCAACCCACCTTTGAGATTCATATATAGCCTTTAACACTATGCAACTTTGTACTTTGCGTAGCAGGGGCGGGGTGGGGGGAAAGAAACTATTATCTGACACACTGGTGCTATTAATTATTTCAAATTTATATTTTTGTGTGAATGTTTTGTGTTTTGTTTATCATGATTATAGAATAAGGAATTTATGTAAATATACTTAGTCCTATTTCTAGAATGACACTCTGTTCACTTTGCTCAATTTTTCCTCTTCACTGGCACAATGTATCTGAATACCTCCTTCCCTCCCTTCTAGAATTCTTTGGATTGTACTCCAAAGAATTGTGCCTTGTGTTTGCAGCATCTCCATTCTCTAAAATTAATATAATTGCTTTCCTCCACACCCAGCCACTGTAAAGAGGTAACTTGGGTCCTCTTCCATTGCAGTCCTGATGATCCTAACCTGCAGCACGGTGGTTTTACAATGTTCCAGAGCAGGAACGCCAGGTTGACAAGCTATGGTAGGATTAGGAAAGTTTGCTGAAGAGGATCTTTGACGCCACAGTGGGACTAGCCAGGAATGAGGGAGAAATGCCCTTTCTGGCAATTGTTGGAGCTGGATAGGTAAGTTTTATAAGGGAGTACATTTTGACTGAGCACTTAGGGCATCAGGAACAGTGCTACTTACTGATGGGTAGACTGGGAGAGGTGGTGTAACTTAGTTCTTGATGATCCCACTTCCTGTTTCCATCTGCTTGGGATATACCAGAGTTTACCACAAGTGTTTTGACGATATACTCCTGAGCTTTCACTCTGCTGCTTCTCCCAGGCCTCTTCTACTATGGCAGGAGATGTGGCGTGCTGTTGCAAAGTTTTCACGTCATTGTTTCCTGGCTAGTTCATTTCATTAAGTGGCTACATCCTAACATATGCATTTGGTCAAGGTTGCAGAAGAGGACTGAAGATTGACTGCCAAGCTAGTTTGGGTGAAGTTCACTCCAGCAAGTCTCAGGCCACAATGGGGTGGTTTGGTTTGGTTTCCTTTTAACTTTCTTTTTGTTATTTGCTTTTCTCCTCCACCTGTGTGGTATATTTTTTAAGCAGAATTTTATTTTTTAAAATAAAAGGTTCTTTACAAGATGATACCTTAATTACACTCCCGCAACACAGCCATTATTTTATTGTCTAGCTCCAGTTATCTGTATTTTATGTAATGTAATTGACAGGATGGCTGCTGCAGAATGCTGGTTGACACAGGGATTATTATACTGCTATTTTTCCCTGAATTTTTTTCCTTTGAATTCCAACTGTGGACCTTTTATATGTGCCTTCACTTTAGCTGTTTGCCTTAATCTCTACAGCCTTGCTCTCCGGGGTGGTTAATAAAATGCAACACTTGGCATTTTTATGTTTTAAGAAAAACAGTATTTTATTTATAATAAAATCTGAATATTTGTAAC