Transcript asmbl_14958

Sequence
Transcript Sequence for observation asmbl_14958 of TGE0003057:
GTCTGAGGCAATGGGGGCAAGCTTGGAGCCGACAGTGCTGAGCAGGCAGGAGCCAAGAGAGGGGAAGCTTGAGCCTCACGCAGTTAGGGGTGCGCTGGAGAGGGTGGGGCCCGACTCCGCCACACCCCAACGGTCCTTCCCCCTCCTCACCACTCCCGCCCCCACCCCCAATGGATCTGGGACTGCCCCTTTAAGAGTAGTGGCCCCTCCTCCCTTCAGAGGAGGACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGACCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCCAACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAGAAGGAGCTGGAGAAGACTTATTCTGCCAAGCTGGACAATGCCAGGCAGTCTGCTGAGAGGAACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGCAGTCGCGCATCCGCATCGACAGCCTCTCTGCCCAGCTCAGCCAGCTCCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTTCGAGACCTGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGGCTGCTGGCGGAAAAGGAGCGGGAGATGGCCGAGATGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTTCTGGACATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTGGAGGGCGAGGAGGAGAGGCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAAAAAGCGCAAACTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACGCACGCACTAGCGGGCGCGTGGCCGTGGAGGAGGTGGATGAGGAGGGCAAGTTTGTCCGGCTGCGCAACAAGTCCAATGAGGACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAGAATGGAGATGATCCCTTGCTGACTTACCGGTTCCCACCAAAGTTCACCCTGAAGGCTGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCTACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGCGGGAACAGCCTGCGTACGGCTCTCATCAACTCCACTGGGGAAGAAGTGGCCATGCGCAAGCTGGTGCGCTCAGTGACTGTGGTTGAGGACGACGAGGATGAGGATGGAGATGACCTGCTCCATCACCACCACGTGAGTGGTAGCCGCCGCTGAGGCCGAGCCTGCACTGGGGCCACCCAGCCAGGCCTGGGGGCAGCCTCTCCCCAGCCTCCCCGTGCCAAAAATCTTTTCATTAAAGAATGTTTTGGAACTTTACTCGCTGGCCTGGCCTTTCTTCTCTCTCCTCCCTATACCTTGAACAGGGAACCCAGGTGTCTGGGTGCCCTACTCTGGTAAGGAAGGGAGTGGGAACTTTCTGATGCCATGGAATATTCCTGTGGGAGCAGTGGACAAGGGTCTGGATTTGTCTTCTGGGAAAGGGAGGGGAGGACAGACGTGGGGCATGCCCGCCCTGCCTCTCTCCCCCATTCTTGTTGCATGCATATCCTCTCATTTCCCTCATTTTTCCTGCAAGAATGTTCTCTCTCATTCCTGACCGCCCCTCCACTCCAATTAATAGTGCATGCCTGCTGCCCTACAAGCTTGCTCCCGTTCTCTCTTCTTTTCCTCTTAAGCTCAGAGTAGCTAGAACAGAGTCAGAGTCACTGCTCTGGTTCTCTGTCCCCAAGTCTTCCTGAGCCTTCTCCCCTTTTATGTCTTCCCTCTCCTCCTCCGGGCCCCTAGCCTCCCAAACCCCCATTGCCCGCTGGCTCCTTGGGCACAGAACCACACCTTCCTGCCTGGCGGCTGGGAGCCTGCAGGAGCCTGGAGCCTGGTTGGGCCTGAGTGGTCAGTCCCAGACTCGCCGTCCCGCCTGAGCCTTGTCTCCCTTCCCAGGGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAATCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAACCCAGGTGAGTTGTCTCTGCTTTGTCTCCAAATCCTGCAGGCGGGTCCCTGGTCATCGAGGGGTAGGACGAGGTGGCCTTGCAGGGGGGAGAGCCTGCCTTCTCTTCCGCAGCCCGGGGGAGTGGGAGCCTCCTCCCCACAGCCTGAGTCCTAGACAGCCCACCTCTGCATCCTGCCCCTCTTGTCTGAGCCCCAGACTGGAGGGCAGGGGCAGGGCTGGAGTGTGAGGGATGGGGG