Transcript asmbl_144847

Sequence
Transcript Sequence for observation asmbl_144847 of TGE0002707:
GGCGGGAGCTCAGGACCGGCGCCTTCTCCTTGCTTCTGGGGGTCGTGGCCTTGCTCCCGCTGTGCGGGAAAAGAATCCAGGCCCTTCCACGCGCGTGTGGGTGCGGGGGCCCCGAAGTGCTCGTGGTTCCCCGCTAGGTCTCCGCTGGGGCAGGAACCGGAATCATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTCGGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCCGAAGATCAGAAACGACTAAAGCAAGCCAAAGAGCTGGACCGAGAGAGGGCTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATGTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGGCTAGGCAGCTGGAAGAGAAAGACCGAGTGCTAAAGAAGCAGGATGCATTCTACAAAGAACAGCTGGCTAGACTGGAGGAGAGGAGCTCAGAGTTCTACAGAGTCACCACTGAACAATATCAGAAAGCTGCTGAAGAGGTGGAAGCAAAGTTCAAGCGATATGAGTCTCATCCAGTCTGTGCTGATCTGCAGGCCAAAATTCTTCAGTGTTACCGTGAGAACACCCACCAGACCCTCAAATGCTCCGCTCTGGCCACCCAGTATATGCACTGTGTCAATCATGCCAAACAGAGCATGCTTGAGAAGGGAGGATAAAAACTTTCAGAATGAGCAAAACACCATCAACGTTAATTCCAGAGATGGAACATTTTTTTTCCTAGTGAGAAAACAACCCATTTGAAGAGAAGACCACTAATGAGAAGACCACTAAAGAGAGACATCAAGAATGGATTCAGCAGAATCATTTCACGTTTTGAACAGCAGCAGTTTGAAGGGCCAAAGCCTTGATCAGGGATCAGTCATTAAAGGACACTCTTGAGTATTAGTAAACCCTCTTATGATGATTAAAAGAGAAGGGCAGCCCTCTCCACCTTTTGGTACTTTCTATTCAACTTGCACTGACCATAAAATGTTTCTCTTCTGAACAAGCCCCATCATTTGGTGAACCTCCACCCTAACAAAGTAGGATGGGGTTGGGGGCTAAATTAATTGGAGTGGGGCGAGGAGAGAGCCAGAAAACATAGATCCGAGGGCAGCAGTGCTGGGTGGAGAGAGCCAGAAAACAGATCTGGAGGCAGCAGTGCTGGATGGAATTGTCTAGGCTGTGGCATGTTGGTTTTGTCTTTCTTTTCTCCTTTGATTATGTAAGAGCTATTTCATTATAACTTATTATGGTGATTATACAGGCAAGAAGACAAAAAGGAGAGAAAATGTACCTCTTCTACTGGAATAATGTTTATGATTACAAGTGAGATAAGGTATTTTTATCAATATGAAGGCAACCTTGGCTGATAAAACCTCTATAGTGAATACTCACATCTTTACTTCACTCACTATCAATAATAAATATATTTTCTGACAAA