Transcript asmbl_31877

Sequence
Transcript Sequence for observation asmbl_31877 of TGE0004857:
TGCGTGGAGTCAGCTCGCGGGTCTCCGAGACTCGAGAACTTGAGAACTTCTTTGCGTCCGGGGGATTGCGCCCCGCGGCTCGGCGGCCGTAATCATGCCACAAAACGAGTATATTGAGTTACACCGTAAGCGCTATGGATATCGTTTGGATTACCATGAGAAAAAGAGAAAGAAGGAAGGTCGAGAAGCTCATGAACGTTCAAAGAAGGCAAAAAAGATGATTGGTCTCAAAGCTAAGCTCTACCATAAACAGCGCCATGCTGAGAAGATACAAATGAAAAAGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACTCCACAAGGAGCAGTACCTGCCTATCTACTGGACAGAGAGGGACAGTCCCGAGCCAAAGTACTTTCCAATATGATTAAACAAAAACGAAAAGAGAAAGCGGGAAAATGGGAAGTCCCTCTGCCCAAAGTTCGTGCTCAGGGGGAAACAGAGGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTGGAGATGGCTTTACTCGAAAACCACCTAAATATGAAAGATTCATTAGGCCAATGGGCTTACGTTTCAAGAAGGCCCATGTAACACATCCTGAACTGAAAGCCACCTTTTGCCTGCCAATACTTGGTGTAAAGAAAAATCCCTCATCCCCACTTTATACAACTTTGGGTGTTATTACCAAAGGTACTGTCATTGAAGTGAATGTGAGCGAGTTGGGCCTTGTGACACAAGGAGGCAAGGTTATTTGGGGAAAATATGCCCAGGTTACCAACAATCCTGAAAACGATGGATGCATAAATGCAGTCTTACTGGTTTGACAGTAGTTTCATACAAGTAACTCCTTATAATTATTGAAGACTATGCACCAATCAGGAAAACCATCTTTACCTGTGATGTTTCTGAGTACTACCAAACAGGTTACATGTCTGTACTCATTGACCTATTTATTTTATTGTAAAGAACATTAAAATGGTCCAGTTTTATAAATTGGTCTTTATTTTGGGGTCTGTTTAATGTTTAGATGTTCATGAAATGGAATAATTAAAAAGCAGTTATAGAAATGTCCTGCTTTATCAGTATCTGTATTAGTAAGTAGGTATTCAGGAATGCTAATTTGTCATTACTGGAAAAGCCAGTGTAGTTGAAAACTCCTTTAATCAAGGGTTAGTGCACACTTAAATTTGGGGCCTAGGCTACGAAACTTTGTCACGTCTAAAATCTTCCTGAAGTCTTCCACTTCATTAATCCTAAGAAATGTATATTAATACACAGTAACATTTGTTAAGTTTATAAAAGTATTCACATTAAAATTATATGAGAAAAGGCACACACTACACTAAATAGAATTCTGAAGAACTTACTTAGGTGAGTCTTTTA