Transcript asmbl_27004

Sequence
Transcript Sequence for observation asmbl_27004 of TGE0000961:
GGCGGGACGGCGGGATCCGGTGGGAGCCGGAGTCCCGCCGAGGGGGGCTGGAGGTGGAGGGGCCCGGCGAGGCCGCGATGAAGCCGAGCGGCGAGGACCAGGCGGCGCTGGCGGCCGGCCCCTGGGAGGAGTGCTTCCAGGCGGCCGTGCAGCTGGCGCTGCGGGCAGGACAGATCATCAGAAAAGCCCTTACTGAGGAAAAACGTGTCTCAACAAAAACATCAGCTGCAGATCTTGTGACAGAAACAGATCACCTTGTGGAAGATTTAATTATTTCTGAGTTGCGAGAGAGGTTTCCTTCACACAGGTTCATTGCAGAAGAGGCCGCGGCTTCTGGGGCCAAGTGTGTGCTCACCCACAGCCCGACGTGGATCATCGACCCCATCGACGGCACCTGCAATTTTGTGCACAGATTCCCGACTGTGGCGGTTAGCATTGGATTTGCTGTTCGACAAGAGCTTGAATTCGGAGTGATTTACCACTGCACAGAGGAGCGGCTGTACACGGGCCGGCGGGGTCGGGGCGCCTTCTGCAATGGCCAGCGGCTCCGGGTCTCCGGGGAGACAGATCTCTCAAAGGCCTTGGTTCTGACAGAAATTGGCCCCAAACGTGACCCTGCGACCCTGAAGCTGTTCCTGAGTAACATGGAGCGGCTGCTGCATGCCAAGGCGCATGGGGTCCGAGTGATTGGAAGCTCCACATTGGCACTCTGCCACCTGGCCTCAGGGGCCGCGGATGCCTATTACCAGTTTGGCCTGCACTGCTGGGATCTGGCGGCTGCCACAGTCATCATCAGAGAAGCAGGCGGCATCGTGATAGACACTTCGGGTGGACCCCTCGACCTCATGGCTTGCAGAGTGGTTGCGGCCAGCACCCGGGAGATGGCGATGCTCATAGCTCAGGCCTTACAGACGATTAACTATGGGCGGGATGATGAGAAGTGACTGCGGCTGAGGCAAAGCTGCTCCCAAGGCCTCCCTGGGCTGCTGTGGGCTCCTGGGGAGGTGGCCCTCGTGGCCCACGCTCCATGCCAGTGGCTCACGCTCTGCTCCTGGCTACCCCAGAGGGAGTTGTCACGCTACAGTGAGTGGCTGGCCTTTTAAATCGACGTCTCTCTCACCAGGATTTGGTGTTTAGCTGTTTCTCTCTTTAATCTCACGTAGCCTTTTTCAGGTTAGTACGTGTTCTTCTGTCAGGGCCAAAACTCAAATCTCCTGTGAAATACGTATTGATAATCCAATCTTGATTTTTCCCCCCAGAATATAAATCTCAGGTAATAAGGCTTTAGAACTGCTGATAAAGCGGATCGTTCTCAGGCCCTCCCCCCGGAGTACTTCAGAATGCAATAAATCAAAATAATGGCCCTGTGTGTATCTGTTTCCTCTATAAGCATGTCGCCTGATTCCCAAACAACTCTGTGGCTCTCATCCACTGCTGTGGATCTATGCTCTCAGGAAGCTTTGCGA