Transcript asmbl_136782

Sequence
Transcript Sequence for observation asmbl_136782 of TGE0060855:
CAAGGCCACCAAGAAGCCCCCGTCAGGGAAGAGGCCCCCCATTCTGGCTCCCTCAGAAACCCTGGAGTGGCCACTGCCCCCACCCCCCAGCCCTGGCCCCGAGGAGCTACCCCAGGAGGGAGGGGCGCCCCTCTCAAATAACTGGCAGAATCCAGGAGAGGAGACCCATGTGGAGGCACGGGAGCACCAGCCTGAGCCGGAGGAGGAGACCGAGCAACCCACACTGGACTACAATGACCAGATCGAGAGGGAGGACTATGAGGACTTTGAGTACATTCGGCGCCAGAAGCAACCCAGGCCACCCCCAAGCAGAAGGAGGAGGCCCGAGCGGGTCTGGCCAGAGCCCCCTGAGGAGAAGGCCCCGGCCCCAGCCCCGGAGGAGAGGATTGAGCCTCCTGTGAAGCCTCTGCTGCCCCCGCTGCCCCCTGACTATGGTGATGGTTACGTGATCCCCAACTACGATGACATGGACTATTACTTTGGGCCTCCTCCGCCCCAGAAGCCCGATGCTGAGCGCCAGACAGACGAAGAGAAGGAGGAGCTGAAGAAACCCAAAAAGGAGGACAGCAGCCCCAAGGAGGAGACCGACAAGTGGGCAGTGGAGAAGGGCAAGGACCACAAAGAGCCCCGAAAGGGCGAGGAGTTGGAGGAGGAGTGGACGCCTACGGAGAAAGTCAAGTGTCCCCCCATTGGGATGGAGTCACACCGTATTGAGGACAACCAGATCCGAGCCTCCTCCATGCTGCGCCACGGCCTGGGGGCACAGCGCGGCCGGCTCAACATGCAGACCGGTGCCACTGAGGACGACTACTATGATGGTGCGTGGTGTGCCGAGGACGATGCCAGGACCCAGTGGATAGAGGTGGACACCAGGAGGACTACCCGGTTCACAGGCGTCATCACCCAGGGCAGAGACTCCAGCATCCATGACGATTTTGTGACCACCTTCTTCGTGGGCTTCAGCAATGACAGCCAGACATGGGTGATGTACACCAACGGCTATGAGGAAATGACCTTTCATGGGAACGTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATCCGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGCTCTGTGGCCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTGGATTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTCATGAAGGTGGTGAACGAGGAGTGCCCCACCATCACCCGCACTTACAGCCTGGGCAAGAGCTCACGAGGCCTCAAGATCTATGCCATGGAGATCTCAGACAACCCTGGGGAGCATGAACTGGGGGAGCCCGAGTTCCGCTACACTGCTGGGATCCATGGCAACGAGGTGCTGGGCCGAGAGCTGTTGCTGCTGCTCATGCAGTACCTGTGCCGAGAGTACCGCGATGGGAACCCACGTGTGCGCAGCCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCACTGAACCCTGATGGCTACGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCGCTGGGACTGTGGACTGAGGAGGGCTTTGACATCTTTGAAGATTTCCCGGATCTCAACTCTGTGCTCTGGGGAGCTGAGGAGAGGAAATGGGTCCCCTACCGGGTCCCCAACAATAACTTGCCCATCCCTGAACGCTACCTTTCGCCAGATGCCACGGTATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGAGAAGAACCCCTTCGTGCTGGGAGCAAATCTGAACGGCGGCGAGCGGCTAGTATCCTACCCCTACGATATGGCCCGCACGCCTACCCAGGAGCAGCTGCTGGCCGCAGCCATGGCAGCAGCCCGGGGGGAGGATGAGGACGAGGTCTCCGAGGCCCAGGAGACTCCAGACCACGCCATCTTCCGGTGGCTTGCCATCTCCTTCGCCTCCGCACACCTCACCTTGACCGAGCCCTACCGCGGAGGCTGCCAAGCCCAGGACTACACCGGCGGCATGGGCATCGTCAACGGGGCCAAGTGGAACCCCCGGACCGGGACTATCAATGACTTCAGTTACCTGCATACCAACTGCCTGGAGCTCTCCTTCTACCTGGGCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCGCGAGTGGGAGAACAACAAGGAGGCGCTGCTCACCTTCATGGAGCAGGTGCACCGCGGCATTAAGGGGGTGGTGACGGACGAGCAAGGCATCCCCATTGCCAACGCCACCATCTCTGTGAGTGGCATTAATCACGGCGTGAAGACAGCCAGTGGTGGTGATTACTGGCGAATCTTGAACCCGGGTGAGTACCGCGTGACAGCCCACGCGGAGGGCTACACCCCGAGCGCCAAGACCTGCAATGTTGACTATGACATCGGGGCCACTCAGTGCAACTTCATCCTGGCTCGCTCCAACTGGAAGCGCATCCGGGAGATCATGGCCATGAACGGGAACCGGCCTATCCCACACATAGACCCATCGCGCCCTATGACCCCCCAACAGCGACGCCTGCAGCAGCGACGCCTACAACACCGCCTGCGGCTTCGGGCACAGATGCGGCTGCGGCGCCTCAACGCCACCACCACCCTAGGCCCCCACACTGTGCCTCCCACGCTGCCCCCTGCCCCTGCCACCACCCTGAGCACTACCATAGAGCCCTGGGGCCTCATACCGCCAACCACCGCTGGCTGGGAGGAGTCGGAGACTGAGACCTACACAGAGGTGGTGACAGAGTTTGGGACCGAGGTGGAGCCCGAGTTTGGGACCAAGGTGGAGCCCGAGTTTGAGACCCAGTTGGAGCCTGAGTTTGAGACCCAGCTGGAACCCGAGTTTGAGGAAGAGGAGGAGGAGGAGAAAGAGGAGGAGATAGCCACTGGCCAGGCATTCCCCTTCACAACAGTAGAGACCTACACAGTGAACTTTGGGGACTTCTGAGATCAGCGTCCTACCAAGACCCCAGCCCAACTCAAGCTACAGCAGCAGCACTTCCCAAGCCTGCTGACCACAGTCACATCACCCATCAGCACATGGAAGGCCCCTGGTATGGACACTGAAAGGAAGGGCTGGTCCTGCCCCTTTGAGGGGGTGCAAACATGACTGGGACCTAAGAGCCAGAGGCTGTGTAGAGGCTCCTGCTCCACCTGCCAGTCTCGTAAGAGATGGGGTTGCTGCAGTGTTGGAGTAGGGGCAGAGGGAGGGAGCCAAGGTCACTCCAATAAAACAAGCTCATG