Transcript asmbl_31821

Sequence
Transcript Sequence for observation asmbl_31821 of TGE0004845:
CCTGCATCTCCCAGCGTGCTGCAGAGGAACGGCTGTTGATCTGTGTTGAATTCAGGTCCCCGGCTTGTCGGGGGCTCGAGTTCTCGGCTTCTCTCCTCTGAGCTGCTACCTGTTGAAGAGGAAGCCATGGCGTTCCGGGTCACCAGGAACACGAAAATTAATGCTGAAAATAAGGTGAAGATCAATATGGCAGGCGCAAAGCGCGTGCCTGTGTCCACTGCTGCAGCCTCCAAGCCGGGCCTGAGACCAAGAACCGCCCTTGGAGACATCGGTAACAAAGTCAGTGAACAGCCACAGGCCAAATTACCTCTGAAAAAGGAAGCAAAAACTTTAGCTGCTGGAAAAGTTATTGCTAAAAAAGTACCTAAACCTCTGGAAAAGGCACTGGAGCCTGTGCCTGAGCCTGCGCAGGAGCCTGTGCCGGAGCCTGCATCAGAGCCAGAACCTGAGTCTGTTAACAAAGAAGAAAAACTTTCTCCTGAGCCTATTGTGGTTGATACTCCCTCTCCAAGCCCAATGGAAACGTCTGGATGTGCCCCTGCAGAAGAATATCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTGAACGATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGTGAATATGTAAAAGATATCTATGCTTATCTGAGGCAACTTGAGGAAGAGCAAGCAGTCAGACCAAAATACTTACTGGGTCGTGAAGTCACTGGAAACATGAGAGCCATCCTAATTGATTGGCTAGTGCAAGTTCAAATGAAATTCAGATTACTGCAGGAGACCATGTACATGACTGTTTCCATTATTGATCGGTTCATGCAGAATAATTGTGTTCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATCGGTGACTTTGCTTTTGTGACTGACAACACTTACACTAAGCTCCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAATTTTAGTCTGGGTCGCCCTCTACCCCTGCATTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTGGAGCAACATACTTTGGCCAAATACTTGATGGAACTAACGATGTTGGACTATGATATGGTGCACTTTTCTCCTTCTCAGATCGCAGCGGGAGCTTTTTGTTTAGCACTGAAAATTCTCGATAATGGTGAATGGACACTAACTCTACAGCATTACCTGTCATATACTGAAGAATCCCTTCTTCTTGTTATGCAACACCTGGCTAAGAATATAGTCATGGTGAATCGTGGACTTACAAAGCACATGACTATCAAGAACAAGTATGCCACAGCTAAGCATGCTAAGATCAGCACTCTTGCACAGCTGAATTCTGCACTAGTTCAAGATCTGGCCAAGGCTGTGGCAAAAGTGTAACTTGTGAAATTGAGTTGGAGTACTGTAATGATCTGCAAATAAAATTGGCACCATGTGCTATCTGTATATATTACATGTTACATTTATTTACTTTTAATAAAGTTGTGGACCTTTTTACTTCTTACCTTAACTCATTTGAATGTGGCCACTTCCTGCTCTTGGGGAACCCTAAAAGTAGCCTTAAAGATATGCTAGGGAATATAGAGTATTAAAAAAAGCGCTTTCAGTTAAACTAGGGACCCAACTAATATATATAATTGTTGCTTATATGATTCTTGTTTTATATACCTACCTGGATTTTGCTTTATAAATAGGAATTACTAAGGTTATGAAGGCATTTAAAACCCTTACCTTCCATAGGGCATACTGCATGTAAGCCTAGTCATCTTGGAGCATCTGCTGCCTTGTTCTACTTAAGTAAAAGTCTGCCACCTCATCCCTAGTCCGCCATTTTCTGTTTCTTCTGGTGTTTGCTGCCATAAATTCTAAGTAATCTACTTTTACCACTATTTCTTAAATTATCAACTTTAGTATCAACTTTTTCACTTGGAAAAATGACTTTATATTCTAAACATACTTTACTTTTTCTTTATTAGTTGAGAAAATAAAACAGACTCCTCAAAACATACCAAAGTATCTTAAAAAGTTTATTTTACCTCTCCCCGCAACTCTCCTACATCTCCACGCCCTCGACCTGAAGATGTCAACAGTTTGAGATGTAGCCTTCCATGACTTCTATAAACATAGATGTGCATAGATATAAATTGTCATGGAGATTTTAAAACATAAGATTTTTCTACATGCTTAGCAATTCCTTTCAATATGTATAGACATCTGTTTTAGGGTATTACGTTCCAGAGTATAATGTATTCAGTCATTCAATTGACATTTGGATGGCTTTTTTCTTTGCCCCTAAAGACAATGCTGTTTAAATATCATTAAGTATCATGTTGGTTTTTTGGGGGTTTTTTTTACATAAATTGGGTTCTCCAAAGGGTATGTGTGTTCTCACTTAAAGCAGGTCCTGTCAAATGACTTTCTCAGTGTCATCAGCAATGTACAAAAGTGCTGGTTTTCTCTGCAGTTTTGTCAAAACTAAAGATAATCTCTTTAATTTCTGTGAATTTGGGAATTCTACCTTGTTTGCTGTTTTAATGTATACTCCTAATGATTACTTGAATAAATTTTTGTTGTCTACT