Transcript asmbl_127898

Sequence
Transcript Sequence for observation asmbl_127898 of TGE0029079:
CGCTCGGAGGCGAGTGGAACTGGATCGGGTTTGCTGCCAGCGGCGTGAGCTTCGGCCGCCATTTTACAACAGCTCCACTCGCGCCGGACACAGGGAGCAGCGAGCACGCGTTTCCCGCAACCCGATACCATCGGACAGGATTTCTCCGCCTCAGCCCAACGGGGAGGGCTAGTTGCACATAGTGATTTAGATGAAAGAGCTATTGAAGCTTTAAAAGAATTCAATGAAGACGGTGCATTGGCAGTTCTTCAACAGTTTAAAGACAGTGATCTCTCTCATGTTCAGAACAAAAGTGCCTTTTTATGTGGAGTCATGAAGACTTACAGGCAGAGAGAAAAACAAGGGACCAAAGTAGCAGATTCTAGTAAAGGACCAGATGAGGCAAAAATTAAGGCACTCTTGGAAAGAACAGGCTACACACTTGATGTGACCACTGGACAGAGGAAGTATGGAGGACCACCTCCAGATTCCGTTTATTCAGGTCAGCAGCCTTCTGTTGGCACTGAGATATTTGTGGGAAAGATCCCAAGAGATCTATTTGAGGATGAACTTGTTCCATTATTTGAGAAAGCTGGACCTATATGGGATCTTCGTCTAATGATGGATCCACTCACTGGTCTCAATAGAGGTTATGCGTTTGTCACTTTTTGTACAAAAGAAGCAGCTCAGGAGGCTGTTAAACTGTATAATAATCATGAAATTCGTTCTGGAAAACATATTGGTGTCTGCATCTCAGTTGCCAACAATAGGCTTTTTGTGGGCTCTATTCCTAAGAGTAAAACCAAGGAACAGATTCTTGAAGAATTTAGCAAAGTAACAGAGGGTCTTACAGACGTCATTTTATACCACCAACCGGATGACAAGAAAAAAAACAGAGGCTTTTGCTTTCTTGAATATGAAGATCACAAAACAGCTGCCCAGGCAAGGCGTAGGTTAATGAGTGGTAAAGTCAAGGTCTGGGGGAATGTTGGAACTGTTGAATGGGCTGATCCTATAGAAGATCCTGATCCTGAGGTTATGGCAAAGGTAAAAGTGCTGTTTGTACGCAACCTTGCCAATACTGTAACAGAAGAGATTTTAGAAAAGGCATTTAGTCAGTTTGGGAAACTGGAACGAGTGAAGAAGTTAAAAGATTATGCGTTCATTCATTTTGATGAGCGAGATGGTGCTGTCAAGGCTATGGAAGAAATGAATGGCAAAGACTTGGAGGGAGAAAATATTGAAATTGTTTTTGCCAAGCCACCAGATCAGAAAAGGAAAGAAAGAAAAGCTCAGAGGCAAGCAGCAAAAAATCAAATGTATGACGATTACTACTATTATGGTCCACCTCATATGCCCCCTCCAACAAGAGGTCGAGGGCGTGGAGGTAGAGGTGGTTATGGATATCCTCCAGATTATTATGGATATGAAGATTATTATGATTATTATGGTTATGATTACCATAACTATCGTGGTGGATATGAAGATCCATACTATGGTTATGAAGATTTTCAAGTTGGAGCTAGAGGAAGGGGTGGTAGAGGAGCAAGGGGTGCTGCTCCATCCAGAGGTCGTGGGGCTGCTCCTCCCCGCGGTAGAGCCGGTTATTCACAGAGAGGAGGTCCTGGATCAGCAAGAGGCGTTCGAGGTGCGAGAGGAGGTGCCCAACAACAAAGAGGCCGCGGGCAGGGAAAAGGGGTCGAGGCCGGTCCTGACCTGTTACAATGAAGACTGACTTGCTATGTGGGATTACACCAGAAGCTTGCAGTGGAGTAATGGTAAGGAAATCAAGCAACCTTAAATATGTCGGCTGTATAGGAGCATATTCTATTGCAGAAGACCTTCCTATGAAGATCATGGAATCAAATACGGGACATTGAACTAATACTTGGACTTTGATATGAATTTCTTTAACAATTTTCTCTGCAGTGCAAGTTATTAAACTAAAGCTACTCTATTTTCAAAATGTGTTCCAACAGAAATCCTTCATAACTCCTAGCATGGTATCTTAATAAAGAATAAAGTTCTTTTAAAAATCTGCTCTAAGTAGATTTTTCCCCTTTTTTAAATTAAGGATCCCAACAGTGGTATTTTGAAATATTCTCTTGAATTTGTGCATTTAAATTTTATTGCAGTGGTATAGATGAATGCCACTGATGGTATCCTTAAATTTTATTTCTGCTCACCAAGGTTAATCATGATTGTCTATATCTTTTTTATAGTGATCACTTTTGAATTGTGTTCAGATATGCAGTTTCAGGTGTAATCATCAGAGCTGGTTAGTCAGGCATTCCAGATAGTGGTTCTTTTCAGAACCTTTTTAAAAGGGTTGGTTAACTACCTCAGTAGCAGAGGATTGAACTATACCCTGTCTGTACTGTACATAGAAAATCTTTGTAGATAAAAGCAAGGCTTGTTAAATATGATATGAGGGTAAGATTTTAATATACCAAATGTAACATTCTTAGTTGCCTTTAGTTTCAGAGGCTTGTAAGACTTCCTCATGACCATCATAACAGGCCTTGCTTTTGTCGTATTTTGTGGCTGAAAAAGCAGCCTTGCTTCTTCAGATATTGTAGTTATTTGGATGTATAATAGTTTAGCAAGATGTTACTTTTGTAAGACATCAGATGTTCAAAAAAGTGCATCCGAACTTGTACTAAATACTGCAGTGTCCCTTTATAAAAAGTCAGACTAAAACTGACAATTGTACAGCGAAGCCTGACATTTGGATATTTTGAAGTTTTTTCATAAATCATAGAAATTAGTATATGGCTGTAGTTTAGCTTTTTAGGTAAAAGGTATGTTTCATTAGTGCATTTCTTCCTGCTGATCACTGTAAACATGTGAATCAGCTTTCCATTTCTTATGCAGGTCATGATAACTTGTAGAGTAGAGTACAATCATTTGTGCTATGTTTTTAATTTTCTAAAGCACCTTGATGACAGTGAGTGTCCAGTGGTGAAGCATCCTCTATTGAACCACCCTCAAAAATTTTTTTGCCAAGTCCTAAGTTGATAGCTTAAAGTAAAAAGTGAAAATTATAGTTTCATTAGGACTTGGTGTAAAGAAATCCCCTCCCCCCTTCCCCAAAGGGATACTGCAGTTATATCACATACCCAATAGGCACCACGATGAAGATCAGAGCTTATACTTAATTAAGGTTTTATACACACCAGTTCCCCAGTAAATGCAAATTTAACAAGAAAATCAGACATGTCATATGTTCAAAATGCTCATGGCAAACAATCATTTTGCATTCCTGCAAATAAAATTGTTTTATACTGTAAGCTGGAGGCGAGTGTAACTTATTTTTGTAATAAAGTTTTTATTTTTTTTATGTGTCATTAATATAAATGTGTGTTAGTGTAGAAATCTTCTGGTTTAAAAACTTAGAATTGCACACATTTCAGTATGTTTATTTGTACTTACATAATTTTAGAATAGTGGTTGCCAATAGCCTGTATGTTTCACATTAATTGGTTTTTTGTTATCTAAATAAATCATTTTAGTATGTTGTATGTCAGTTACTGGGATAGCTGGGACATAGAGTGTAATTTAAAATTTGTCAATAAGTATTCATTGGAATATATGTAAATGTGCCTTGCCGGTTATTGAAACTTATCTACAAAATGAGTATGGGGTGACAAAAATTAGTTCCTGGTGCTTAATGAAACTTTCTGCCACTGATTTTATATATTACCCCGTGCTTTTTTAAAGTACATCTCTCTCAAAACTTAGTGTAAGTTTGAGGGCTACACAAAACATTTACATTTCATTCTAACATAATGAATATAATAGGTTGTGGAAAGTGGGTAAACTAAATGTAGCCTTCAGTAAAATTGAATCTCAGTGTAATCCTTGGTGCTGGCATTTCTCAGTTCCGAGGAGTTAAATGATCCCATCTAAGAGGTCATTGCCATGCCTATTGGCACTTTACTGTCATAGCATTTTTAAGGGACACTGTCAAGGTGTTTAAGTTCTCAGAATTACTTGTTGGGATTTTAGGACAGGTTTGTTTACTTAAAGTAAGAACTGCATTGTCAAAGTTGAAAGAGGAACACTTTTGTGAGTTCACAAATGTGTTCTTAAGAAAACATTAAAATATGGAGCTCTGGGTTTTCAAGACTATTTGGCATTCTTAATTTGGGGACTTGGGAGGGAAACTGATAAAAAGAAATTGAAGAATTGATGGTTATACTTAAAGAAGGGTAATGTAAACAGTGGTGATGAAATATATACACATCAAGTGAAATTACTTGACAGTGTTCATTTGAATGACTTTGAATTCAAGCCATTATAATTACTTTTAAAATTAAATATCATTTGCACTGTTCTGATAATGGGTGCAGTTTTTGAGCAATATAATCAGAGCTAAATATGCATGTAGTGATTAGTGATGTGAACAATTAACGTTCTGAGAAGAAATACTAACTGTGGTATTTTCAAACTTAAATTTCTGTAGTAAAATCAGTATCAAAGTCTTATCAGATCAAGGAAAAACAGGCAATGCATATAAACATACTTTTGAATGTTGTGTGGCCTATAAAGCAATAATGCAATTTATATGGAATGTCATGGGATATGAGAAATGGAAATGCAAAAATAACTAATCCTTTAGTAAAAATGTCAACATGTTAAAGGGGGAATGTTAACTAATGTAGGTTATTGCTATTTGTGATTTGTTTATGGGTTCTTGGCTTTGACAGCTTCAAAGAATGGACAGTGATAAGTTAAAAGAAATTTTGTATATTGTCAAGGAAAGGGTCTTAAATCCGAGTCAAGTCCCTTCCTTGGGGTAAAAAATGTATTCTTAAAGCATTCTGATGTTAAAAAGAAAACTTAAGTTATCTAACCAAAACAGACGCAAGATTTTGTTTCTGCAGACTACTTGGCAATCAAAAGTGATCATAAATTTAGGTTATCAGTTTTCAGAAAGTTGCTTTGTGAGAAAATTTTGTTAGATATATTCTCCCAAGCATGCTTTTTGTGGAAGGTTTTCAGCCATTGCCACTGAATCAGATGTTAAAAATGAAGGGAAAATTGAGTGTGCACACACACAACTGTTGTACACTCATGATTGCAGTTTTTAGCTTAAGAAACTTTTCTACCAGTTACTGTGAATCTGACTTAAAATGTAAAGTTTCCTCATGATAAAATAGGAACAACATAGAAATGGATTGATGGGGTGATCTGAGTTATTGTATATAAAAGTTTTTAAAGAATAGAATGAACATCAAGCTAGATAGGCAAAAATTGACACATTCAGAACAGCTTTTTTGACTGCGAAGCCAAAAGTTGTCAGAAACAGCAAAAGATCCCTTATTATTACAGAGTATTTTACGTAGTCTCTATTTTAAGGAGAGAAATTAAATAGAAGGGCTTCATGCATTTAGGGGAGGGTGCTAAAACTTCTCAAGTTCGTCAAACTTACAGGAATACCCACCATGATCATTTTCTCTCTAATTATGTATACCACAAAATTTTCATCTGGCCATAGGAATTCACTGGTGGGTGTAAAATTAATGACTAAAGAAATTAAGTGACAAATACATAAAAGAAACAGACTTGTGGGGATATTGTTTTAAGGTGTATTAATTACTCAGTGATGATACCACTCAATAGGGCATGCCACTACTTTTCTTAAGATGCTAATTATGAAGCAGTGCTCACAGGCATTTTTTAACTAGCAAATTAGTAGATGGACTTTTGGGGTCTGTCACTTTTTAAAAGTATTTAAGACTTAAATTCTATTAGCACCACAGTCTGCCTTCAGTAATACACCTAAAATATTTTTCAGGACCAGAAGCATTCAGTTTGAAAATTTGCAGATGCAAACCAGTATTATTACTAACGCTCTGGGTCAAAGATTAGGTTTTTAATATTAACAGTAGTCTGGTAAATATTTAGAAGTCTGGCATTGAGAAACAAAAGCTTGTACCTGACTAGTATTTTTATTTAAAAAAATTAGTTCTGTTAGCTTATTTAAATTGTGTTTTATTTATCCGTAGAATTTATATTTATTTCATTCCTTTCATCTCACTGAAAACTGTCTGCAGGCCCTTTGATTTGGATTAGATGTGTGAAGTACTGTCTTTTGCCAAAAACCTCAAATTACCTGTTCTTTTCAACGTAGTGGGTTTGTGCTTGTTTGGAGATCAGTTCAAAAACTATCTGTACTATCTGTACTGCCTCTGATGTTAAGATTTTATGTATAGCATAAGGAAGCTAGCTCTGACTATATTTTCCTAAGAATAAAGACCTATTTTTGTAGCATGTCTTAGGATCTCCAGGAGTCCAAGAATTATTGTGGGTGTCCTCCAATTCATCACTCTTCACTTAACAGCTTTTAAGTAGACACTTGGAATCTTTAGAGGTCTGTCGCCCTTTGATTATCCATACATTCGAAGTAACTAGCCAATGGTGAAAAATTCCTCAAGATATCCTCAGTTGCAATCACATTACTGGAAGATGAATAGAATAAATGTATTAGGCTGGTCTTAATTTTTGATGGAAATATTCTGTTGTCCCGTACTTGCCATTGGATTTGATAAAGTTAGTGGTAATTTGGAAAGAATCGGGGACTTGCCAATATATTTGTGGGTTTTAGCTTATACCCCTAGGATTTCTTGGTTGCGGGACGAGCAGTTTTGGCCACTTCCATCAGGACAAGACTTTTTAGGTCACTTAGTGCAGGTTTTAGTTTCTATTTTGGATTAACAACATTTATATTGATTATCGAAAAGAAGCTTTCATCATTTCAGAACAGTCCTGGAAGTTTGACTTTGAGTGTGGGAGAAGTCCTAATAAACCATTTTGGAAATTAGTGTCTCCAAGTGTTACAGCTTCCTAAAATGGGTTTCTAACACAGTGGGATCAAAATAAGGTTATTTTAGGATAATATACTGTAAACTTAATTGACTGTCTGATTTTCTACTTTGTCTATAAAGTGGCT