Transcript asmbl_27001

Sequence
Transcript Sequence for observation asmbl_27001 of TGE0000960:
GCGGATTCTTGGCGCCGGAGGAAGAGGCAGGGTCACCCTCTCTCCACGTCAGAGACCTGACTGTGGAGATGGCGGCTCAGAAGATAAACGAGGGGCTGGAACACCTCGCCAAAGCAGAGAAATACCTGAAAACTGGTTTTTTAAAATGGAAGCCAGATTATGACAGTGCCGCTTCTGAATATGGAAAAGCAGCTGTTGCTTTTAAAAATGCCAAACAGTTTGAGCAAGCAAAAGATGCCTGCCTGAGGGAAGCTGTTGCCCATGAAAATAATAGGGCTCTTTTTCATGCTGCCAAAGCTTATGAGCAAGCTGGAATGATGTTGAAGGAGATGCAGAAACTACCAGAGGCCGTTCAGCTAATTGAGAAGGCCAGCATGATGTATCTAGAAAACGGCACCCCAGACACAGCAGCCATGGCTTTGGAGCGAGCTGGAAAGCTTATAGAAAATGTTGATCCAGAGAAGGCTGTACAGTTATATCAACAGACAGCTAATGTGTTTGAAAATGAAGAACGCTTACGACAGGCAGTTGAATTACTAGGAAAAGCCTCCAGACTACTAGTACGAGGACGTAGGTTTGATGAGGCGGCACTCTCTATTCAGAAAGAAAAAAATATTTATAAGGAAATTGAGAATTATCCAACTTGTTATAAGAAAACAATTGCTCAAGTCTTAGTTCATCTACACAGAAATGACTATGTAGCTGCAGAAAGATGTGTCCGGGAGAGCTATAGCATCCCTGGGTTCAATGGCAGTGAAGACTGTGCTGCCCTGGAACAGCTTCTTGAAGGTTATGACCAGCAAGACCAAGATCAGGTGTCAGATGTCTGCAACTCACCGCTTTTCAAGTACATGGACAATGATTATGCTAAGCTGGGCCTGAGTTTGGTGGTTCCAGGAGGGGGAATCAAGAAGAAATCACCTGCAACACCACAGGCCAAGCCTGATGGTGTCACTGCCACGGCTGCTGATGAAGAGGAAGATGAATACTCAGGAGGACTATGCTAGTATTTTGCTTGCTGAAAAGAAAAGGGAAACAAAGGTAAAATCCTGACATGCCATTTCAAGGACTTGGGAATAGATTAGGGATATCCGTACTTCATTACAGTCATGATTTTGGATCCTAATAAAGACTAGTTTTTAGTTACCATCTTCCCAAATCACTCATTGTATCCATTACCTGTGAAGCATATCTTTTTCTTTCCATAAGAGCTTTTCTAAGACACCAGCAGGAATTAACAGAAAATGTACTGTCATGTTTTAATACATTGATTAAAAAATTTGCAAGCCAAATTATACATAAATTATGTTCTAAACAAAAGGGGTAATAAGCATAGGTATTCTCTCTTGGACACTTGTAAGTTACTGTTAGTGAATTGTTTTTTACGTTTCATTTAATAA