Transcript asmbl_127319

Sequence
Transcript Sequence for observation asmbl_127319 of TGE0056398:
GAGGGCTCCTCTTAGGAAGTTATTTAAGAGCCAACTGTCTTGTCTTTCCCGAGTCCGTTTGAGGAAGTCCCCGAGGCGCACAGAGCAAGCCCACGCGAGGGCACCTCTGGAGGGGAGCGCCTGCAGGACCTTGTAAAGTCAAAAATGTCAGAAACTTCCAGGACCGCCTTTGGAGGCAGAAGAGCAGTTCCACCCAATAACTCTAATGCAGCGGAAGATGACCTGCCCACAGTGGAGCTTCAGGGCGTGGTGCCCCGGGGCGTCAACCTGCAAGAGTTTCTTAATGTCACGAGCGTTCACCTGTTCAAGGAGAGATGGGACACTAACAAGGTGGACCACCACACTGACAAGTATGAAAACAACAAGCTGATTGTCCGCAGAGGGCAGTCTTTCTATGTGCAGATTGACTTCAGTCGTCCATATGACCCCAGAAGGGATCTCTTCAGGGTGGAATACGTCATTGGTCGCTACCCACAGGAGAACAAGGGAACCTACATCCCAGTGCCTATAGTCTCAGAGTTACAAAGTGGAAAGTGGGGGGCCAAGATTGTCATGAGAGAGGACAGGTCTGTGCGGCTGTCCATCCAGTCTTCCCCCAAATGTATTGTGGGGAAATTCCGCATGTATGTTGCTGTCTGGACTCCCTATGGCGTACTTCGAACCAGTCGAAACCCAGAAACAGACACGTACATTCTCTTCAATCCTTGGTGTGAAGATGATGCTGTGTATCTGGACAATGAGAAAGAAAGAGAAGAGTATGTCCTGAATGACATCGGGGTAATTTTTTATGGAGAGGTCAATGACATCAAGACCAGAAGCTGGAGCTATGGTCAGTTTGAAGATGGCATCCTGGACACTTGCCTGTATGTGATGGACAGAGCACAAATGGACCTCTCTGGAAGAGGGAATCCCATCAAAGTCAGCCGTGTGGGGTCTGCAATGGTGAATGCCAAAGATGACGAAGGTGTCCTCGTTGGATCCTGGGACAATATCTATGCCTATGGCGTCCCCCCATCGGCCTGGACTGGAAGCGTTGACATTCTATTGGAATACCGGAGCTCTGAGAATCCAGTCCGGTATGGCCAATGCTGGGTTTTTGCTGGTGTCTTTAACACATTTTTACGATGCCTTGGAATACCAGCAAGAATTGTTACCAATTATTTCTCTGCCCATGATAATGATGCCAATTTGCAAATGGACATCTTCCTGGAAGAAGATGGGAACGTGAATTCCAAACTCACCAAGGATTCAGTGTGGAACTACCACTGCTGGAATGAAGCATGGATGACAAGGCCTGACCTTCCTGTTGGATTTGGAGGCTGGCAAGCTGTGGACAGCACCCCCCAGGAAAATAGCGATGGCATGTATCGGTGTGGCCCCGCCTCGGTTCAAGCCATCAAGCACGGCCATGTCTGCTTCCAATTTGATGCACCTTTTGTTTTTGCAGAGGTCAACAGCGACCTCATTTACATTACAGCTAAGAAAGATGGCACTCATGTGGTGGAAAATGTGGATGCCACCCACATTGGGAAATTAATTGTGACCAAACAAATTGGAGGAGATGGCATGATGGATATTACTGATACTTACAAATTCCAAGAAGGTCAAGAAGAAGAGAGATTGGCCCTAGAAACTGCCCTGATGTACGGAGCTAAAAAGCCCCTCAACACAGAAGGTGTCATGAAATCAAGGTCCAACGTTGACATGGACTTTGAAGTGGAAAATGCTGTGCTGGGAAAAGACTTCAAGCTCTCCATCACCTTCCGGAACAACAGCCACAACCGTTACACCATCACAGCTTATCTCTCAGCCAACATCACCTTCTACACCGGGGTCCCGAAGGCAGAATTCAAGAAGGAGACGTTCGACGTGACGCTGGAGCCCTTGTCCTTCAAGAAAGAGGCGGTGCTGATCCAAGCCGGCGAGTACATGGGTCAGCTGCTGGAACAAGCGTCCCTGCACTTCTTTGTCACAGCTCGCATCAATGAGACCAGGGATGTTCTGGCCAAGCAAAAGTCCACCGTGCTAACCATCCCTGAGATCATCATCAAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTTTACCAATCCTTTAAAAGAAACCCTGCGAAATGTCTGGGTACACCTGGATGGTCCTGGAGTAACAAGACCAATGAAGAAGATGTTCCGTGAAATCCGGCCCAACTCCACCGTGCAGTGGGAAGAAGTGTGCCGGCCCTGGGTCTCTGGGCATCGGAAGCTGATAGCCAGCATGAGCAGTGACTCCCTGAGACATGTGTATGGCGAGCTGGACGTGCAGATTCAAAGACGACCTTCCATGTGAATGCACAGGAAGCTGAGATGAACCCTGGCATTTGGCCTCTTGTAGTCTTGGCTAAGGAAATTCTAACGCAAAAATAGCTCTTGCTTTGACTTAGGTGTGAAGACCCAGACAGGACTGCAGAGGGCTCCAGAGTGGAGATCCCACATATTTCAAAAACATGCTTTTCCAAACCCAGGCTATTCGGCAAGGAAGTTAGTTTTTAATCTCTCCACCTTCCAAAGAGTGCTAAGCATTAGCTTTAATTAAGCTCTCATAGCTCATAAGAGTAACAGTCATCATTTATCATCACAAATGGCTACATCTCCAAATATCAGTGGGCTCTCTTACCAGGGAGATTTGCTCAATACCTGGCCTCATTTAAAACAAGACTTCAGATTCCCCACTCAGCCTTTTGGGAATAATAGCACATGATTTGGGCTCTAGAATTCCAGTCCCCTTTCTCGGGGTCAGGTTCTACCCTCCATGTGAGAATATTTTTCCCAGGACTAGAGCACAACATAATTTTTATTTTTGGCAAAGCCAGAAAAAGATCTTTCATTTTGCACCTGCAGCCAAGCAAATGCCTGCCAAATTTTAGATTTACCTTGTTAGAAGAGGTGGCCCCATATTAACAAATTGCATTTGTGGGAAACTTAACCACCTACAAGGAGATAAGAAAGCAGGTGCAACACTCAAGTCTATTGAATAATGTAGTTTTGTGATGCATTTTATAGAATGTGTCACACTGTGGCCTGATCAGCAGGAGCCAATATCCCTTACTTTAACCCTTTCTGGGATGCAATACTAGGAAGTAAAGTGAAGAATTTATCTCTTTAGTTAGTGATTATATTTCACCCATCTCTCAGGAATCATCTCCTTTGCAGAATGATGCAGGTTCAGGTCCCCTTTCAGAGATATAATAAGCCCAACAAGTTGAAGAAGCTGGCGGATCTAGTGACCAGATATATAGAAGGACTGCAGCCACTGATTCTCTCTTGTCCTTCACATCACCCATGTTGAGACCTCAGCTTGGCACTCAGGTGCTGAAGGGTAATATGGACTCAGCCTTGCAAATAGCCAGTGCTAGTTCTGACCCAACCACAGAGGATGCTGACATCATTTGTATTATGTTCCAAGGCTACTACAGAGAAGGCTGCCTGCTATGTATTTGCAAGGCTGATTTATGGTCAGAATTTCCCTCTGATATGTCTAGGGTGTGATTTAGGTCAGTAGACTGTGATTCTTAGCAAAAAATGAACAGTGATAAGTATACTGGGGGCAAAATCAGAATGGAATGCTCTGGTCTATATAACCACATTTCTAAGCCTTTGAGACTGTTCCTGAGCCTTCAGCACTAACCTATGAGGGTGAGCTGGTCCCCTCTATATATACATCATACTTAACTTTACTAAGTAATCTCACAGCATTTGCCAAGTCTCCCAATATCCAATTTTAAAATGAAATGCATTTTGCTAGACAGTTAAACTGGCTTAACTTAGTATATTATTATTAATTACAATGTAATAGAAGC