Transcript asmbl_126595

Sequence
Transcript Sequence for observation asmbl_126595 of TGE0056686:
GGAGGCGCTCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCCCGCTCCATGGCGCTCTTCGTGCGGCTGCTGGCTCTCGCCCTGGCTCTGGCCCTGGGCCCCGCCGCGACCCTGGCGGGTCCCGCCAAGTCGCCCTACCAGCTGGTGCTGCAGCACAGCAGGCTCCGGGGCCGCCAGCACGGCCCCAACGTGTGTGCTGTGCAGAAGGTTATTGGCACTAATAGGAAGTACTTCACCAACTGCAAGCAGTGGTACCAAAGGAAAATCTGTGGCAAATCAACAGTCATCAGCTACGAGTGCTGTCCTGGATATGAAAAGGTCCCTGGGGAGAAGGGCTGTCCAGCAGCCCTACCACTCTCAAACCTTTACGAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGACCGCACGGAGAAGCTGAGGCCTGAGATGGAGGGGCCCGGCAGCTTCACCATCTTCGCCCCTAGCAACGAGGCCTGGGCCTCCTTGCCAGCTGTGAGATGACCTCCGTCTGCCCGGGGGACTCTTATGGGGAACTGCCTTACTTCCCCGAGGGGTGGGCATGATGAATGGGAGTCTGCAGTCATTTCCTACTGTTTCAGGAAGCTTTCTCCTTAACCCCTTAGAAAAGGCTGTGGAACTTGAGCTAAAATATGTCTTACCAGGTTGCGTCTAATGCCCCCCGTTCCCTACTGGGCAGAAAGACTTGGGTGCTTCCTGAGGAGGGATCCTTGGCAGAAGAGAGGCCTGGGCTCACGAGGGCTGAGAACATGTTTCCCAGAGTTGCAAGGACCCATCTCTTAAACACAGAGTCTGCAGCCCCTAACTGACACCCTGTCCTTCCTCCTAGGAAGTGCTGGACTCCCTGGTCAGCAATGTCAACATTGAGCTGCTCAATGCCCTCCGCTACCATATGGTGGGCAGGCGAGTCCTGACTGATGAGCTGAAACACGGCATGACCCTCACCTCTATGTACCAGAATTCCAACATCCAGATCCACCACTATCCTAATGGGATTGTAACTGTGAACTGTGCCCGGCTGCTGAAAGCCGACCACCATGCAACCAACGGGGTGGTGCACCTCATCGATAAGGTCATCTCCACCATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCAAGACACTATTTGAATTGGCTGCAGAGTCTGATGTGTCCACAGCCATTGACCTTTTCAGACAAGCCGGCCTCGGCAATCATCTCTCTGGAAGTGAGCGGTTGACCCTCCTGGCTCCCCTGAATTCTGTATTCAAAGATGGAACCCCTCCAATTGATGCCCATACAAGGAATTTGCTTCGGAACCACATAATTAAAGACCAGCTGGCCTCTAAGTATCTGTACCATGGACAGACCCTGGAAACTCTGGGCGGCAAAAAACTGAGAGTTTTTGTTTATCGTAATAGCCTCTGCATTGAGAACAGCTGCATCGCGGCCCACGACAAGAGGGGGAGGTACGGGACCCTGTTCACGATGGACCGGGTGCTGACCCCCCCAATGGGGACTGTCATGGATGTCCTGAAGGGAGACAATCGCTTTAGCATGCTGGTAGCTGCCATCCAGTCTGCAGGACTGACGGAGACCCTCAACCGGGAAGGAGTCTACACAGTCTTTGCTCCCACAAATGAAGCCTTCCGAGCCCTGCCACCAAGAGAACGGAGCAGACTCTTGGGAGATGCCAAGGAACTTGCCAACATCCTGAAATACCACATTGGTGATGAAATCCTGGTTAGCGGAGGCATCGGGGCCCTGGTGCGGCTAAAGTCTCTCCAAGGTGACAAGCTGGAAGTCAGCTTGAAAAACAATGTGGTGAGTGTCAACAAGGAGCCTGTTGCCGAGCCTGACATCATGGCCACAAATGGCGTGGTCCATGTCATCACCAATGTTCTGCAGCCTCCAGCCAACAGACCTCAGGAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTAGCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGCTTGAAGCACTACAGGAGGAATGCACCACGGCAGCTCTCCGCCAATTTCTCTCAGATTTCCACAGAGACTGTTTGAATGTTTTCAAAACCAAGTATCACACTTTAATGTACATGGGCCGCACCATAATGAGATGTGAGCCTTGTGCATGTGGGGGAGGAGGGAGAGAGATGTACTTTTTAAATCATGTTCCCCCTAAACATGGCTGTTAACCCACTGCATGCAGAAACTTGGATGTCACTGCCTGACATTCACTTCCAGAGAGGACCTATCCCAAATGTGGAATTGACTGCCTATGCCAAGTCCCTGGAAAAGGAGCTTCAGTATTGTGGGGCTCATAAAACATGAATCAAGCAATCCAGCCTCATGGGAAGTCCTGGCACAGTTTTTGTAAAGCCCTTGCACAGCTGGAGAAATGGCATCATTATAAGCTATGAGTTGAAATGTTCTGTCAAATGTGTCTCACATCTACACGTGGCTTGGAGGCTTTTATGGGGCCCTGTCCAGGTAGAAAAGAAATGGTATGTAGAGCTTAGATTTCCCTATTGTGACAGAGCCATGGTGTGTTTGTAATAATAAAACCAAAGAAACATACGTCCTGTGTGCATGGTACAGTGTGCTGACCTGAGGCCGTCATGCTCCTCCACACCTCAATTCTGCTCTGGAGAAGCTCAGAAAGGAG