Transcript asmbl_121006

Sequence
Transcript Sequence for observation asmbl_121006 of TGE0057574:
CCTAATTCTACCCCCCTTGGTGCCAACAGATGAGGTTCACAATCTCTTCCACAAAACATGCAGTTAAATATCTGAGGATATTCAGGGACTTGGATTTGGTGGCAGGAGATCAACATAAACCAAGACAAGGAAGAAGTCAAAGAAATGAATCAAGTAGATTCTCTGGGATATAAGAGGCAGCCGAAGAGTTCACAAGTGTGAAGCCTGGAAGCCGGCGGGTGCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTGCGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGCTGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCGGCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAAGATCCAAGACAGAATAATGAATGGACTCAAACTGCCTTGGCTTCAGGGGAGTCCCGTCAGGACGTTGAGGACTTTTCGACCAATTCAACCCTTTGCCCCACCTTTATTAAAATCTTAAACAACGGGTCCGTGTCATTCATTTAACAGACCTTTATTGGATGTCTGCTATGTGCTGGGCACAGTGCTGGATGGGGAATTCATCATACTTAGGCTTTCTTCATCCTAACTCCCTAAGAAACCCTATCTGTCCTCCTCAAGAAAAGAACTGCGGGGATAGAAGGAGCCAGGAAAGGACTCCTGGCTAGGGCTGCATGGGAGAAACAATGAGTGTGCAGTCAGGGCTTTCTGAGCAGATTATTG