Transcript asmbl_121005

Sequence
Transcript Sequence for observation asmbl_121005 of TGE0057574:
CCTAATTCTACCCCCCTTGGTGCCAACAGATGAGGTTCACAATCTCTTCCACAAAACATGCAGTTAAATATCTGAGGATATTCAGGGACTTGGATTTGGTGGCAGGAGATCAACATAAACCAAGACAAGGAAGAAGTCAAAGAAATGAATCAAGTAGATTCTCTGGGATATAAGGTAGGGGGATTGGGGGGTTGGATAGTGCAGAGTATGGTACTGGCCTAAGGCACTGAGGATCATCCTTTTCCCACACCCACCAGAGAAGGCTTAGGCTCCCGAGTCAACAGGGCATTCACCGCCTGGGGCGCCTGAGTCATCAGGACACTGCCAGGAGACACAGAACCCTAGATGCCCTGCAGAATCCTTCCTGTTACGGTCCCCCTCCCTGAAACATCCTTCATTGCAATATTTCCAGGAAAGGAAGGGGGCTGGCTCGGAGGAAGAGAGGTGGGGAGGTGATCAGGGTTCACAGAGGAGGGAACTGAATGACATCCCAGGATTACATAAACTGTCAGAGGCAGCCGAAGAGTTCACAAGTGTGAAGCCTGGAAGCCGGCGGGTGCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTGCGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGCTGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCGGCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAAGATCCAAGACAGAATAATGAATGGACTCAAACTGCCTTGGCTTCAGGGGAGTCCCGTCAGGACGTTGAGGACTTTTCGACCAATTCAACCCTTTGCCCCACCTTTATTAAAATCTTAAACAACGGGTCCGTGTCATTCATTTAACAGACCTTTATTGGATGTCTGCTATGTGCTGGGCACAGTGCTGGATGGGGAATTCATCATACTTAGGCTTTCTTCATCCTAACTCCCTAAGAAACCCTATCTGTCCTCCTCAAGAAAAGAACTGCGGGGATAGAAGGAGCCAGGAAAGGACTCCTGGCTAGGGCTGCATGGGAGAAACAATGAGTGTGCAGTCAGGGCTTTCTGAGCAGATTATTG