Transcript asmbl_121004

Sequence
Transcript Sequence for observation asmbl_121004 of TGE0057574:
CCTAATTCTACCCCCCTTGGTGCCAACAGATGAGGTTCACAATCTCTTCCACAAAACATGCAGTTAAATATCTGAGGATATTCAGGGACTTGGATTTGGTGGCAGGAGATCAACATAAACCAAGACAAGGAAGAAGTCAAAGAAATGAATCAAGTAGATTCTCTGGGATATAAGGAAAGGAAGGGGGCTGGCTCGGAGGAAGAGAGGTGGGGAGGTGATCAGGGTTCACAGAGGAGGGAACTGAATGACATCCCAGGATTACATAAACTGTCAGAGGCAGCCGAAGAGTTCACAAGTGTGAAGCCTGGAAGCCGGCGGGTGCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTGCGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGCTGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCGGCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAAGATCCAAGACAGAATAATGAATGGACTCAAACTGCCTTGGCTTCAGGGGAGTCCCGTCAGGACGTTGAGGACTTTTCGACCAATTCAACCCTTTGCCCCACCTTTATTAAAATCTTAAACAACGGGTCCGTGTCATTCATTTAACAGACCTTTATTGGATGTCTGCTATGTGCTGGGCACAGTGCTGGATGGGGAATTCATCATACTTAGGCTTTCTTCATCCTAACTCCCTAAGAAACCCTATCTGTCCTCCTCAAGAAAAGAACTGCGGGGATAGAAGGAGCCAGGAAAGGACTCCTGGCTAGGGCTGCATGGGAGAAACAATGAGTGTGCAGTCAGGGCTTTCTGAGCAGATTATTG