Transcript asmbl_10798

Sequence
Transcript Sequence for observation asmbl_10798 of TGE0060779:
GTTCGTGGCTCCCGCCTGTACATCTTCCAGGCCTCACCTGCCGATGCGGGACAGTACGTCTGCCGGGCCAGCAACGGCATGGAGGCCTCCATCACGGTCACAGTAACTGGGACCCAGGGGGCCAACTTAGCCTACCCTGCCGGCAGCACCCAGCCCATCCGCATCGAGCCCTCCTCCTCGCAAGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGTCCCATGCCCAGGTCACGTGGCACAAGCGTGGGGGCAGCCTCCCTGTCCGGCACCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGG