Transcript asmbl_10769

Sequence
Transcript Sequence for observation asmbl_10769 of TGE0059523:
CTTTAAGAGCTTGAGTTTTTTCCACTATACCATATTGCATCTGTTGTAATTGTTAACTAATGTGCATTTTAAAATTCTCATTTGTCTTATGTACTGAGCCCTTATACCAGTGCTAATTTATGTGACTCCTTTCTCCTGCAGCTAAGAGAAAAATACCTTTTTAATTCATTTATAGTACCCAGTTTTTAAAGAAGATTTATTTTGTAAAATTTTGCTTATGGTACATGTCATCTTAGCCTGTAAATAAATTAAAGCATTAATTTTTATCCCTCCCTGGTCTTTTCCTCCTTCTGACTTTATACGTCTTTCTAGAGAGCTTATCTTCTATAATAACAATTCTTTGTTTTAAAGTGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATTCCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCTTCCCCACGTCCCAAGATGGATGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGAGTGGTGCATCAGTGGTTGCTATTCGAAAATACATCATCCATAAGTATCCTTCTCTGGAGCTGGAGAGAAGGGGTTATCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGAGTCATCAAACAGGTTAAAGGAAAAGGTGCTTCTGGAAGTTTTGTTGTGGTTCAGAAATCAAGAAAAACACCTCAGAAATCCAGAAACAGAAAGAATAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAGGATGTCCTCCCACTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATATGTGTCTCAGTATTATCCTAAGCTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAACGCTCTGCAGAGAGCAGTAGAGAGGGGCCAGTTAGAACAGATAACTGGCAAAGGTGCTTCGGGGACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCTACCACTGCTCTGAAGAAGTATGTCCTAGAGAATCACCCAGGAACCAATTCTAACTATCAAATGCATTTGCTGAAAAAAACCCTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGGAAAGGGTTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTATCCCAGCCCAGGAGTTCTGTTTCCGAAGAAAGAGCCAGATGATTCTAGAGATGAGGATGAAGATGAAGATGAGTCATCAGAAGAAGACTCTGAGGATGAAGAGCCGCCACCTAAGAGAAGGTTGCAGAAGAAAACCCCAGCCAAGTCCCCAGGGAAGGCCGCATCTGTGAAGCAGAGAGGGTCCAAACCTGCACCTAAAGTCTCAGCTGCCCAGCGGGGGAAAGCTAGGCCCTTGCCTAAGAAAGCACCTCCTAAGGCCAAAACGCCTGCCAAGAAGACCAGACCCTCATCCACAGTCATCAAGAAACCTAGTGGTGGCTCCTCAAAGAAGCCTGCAACCAGTGCAAGAAAGGAAGTAAAATTGCCGGGCAAGGGCAAATCCACCATGAAGAAGTCTTTCAGAGTGAAAAAGTAAATTTTATAGGAAAAAAGGGTATCATGATGAAATTCAAAATCTTATTTTCTAAGGTCAGTGTGCATTTGTTTAGTTTTGATGCTTTTCAAATTACATTATTTTCCTCCCCTATGAACATTGTGGGGAGGGACTCTAAATAAACCAGTTTAGGCATTTGCTAGCTTTAGGTGCTTTTATTGGTGCCTGCCCTTTTCCTTGTTCATTTTAATTTCTGCAATAATCCTGGACTTTCCTAAACTATGTAATGTATACTTGTCCTTTTTCTCTGCCTCCCCCAACCCCCTGTTGTTTTTATGGTCAGCTTTGCCTTTTTTTTTTCTTCCAATTTTATCTAAACAGTTGCAGAGATTTTTATATTTGTAGAAAGCATCAAGAACGGTATGCCAGTCAGGTCCTGGAAGTAAAATGGAGGCACAATATAGCACTGACTGAGTTGTAAAGCCTCCTGCCTGGAGACTTCAGTTATAGCTGTAATAATTAATCTTATTTATAAAAGCCACTCCACTAACCTTTTCTCTCCAACTGTAAACACAGAGACAGCTTTGGGAATAAGCCAAAAACAGGGTGATCTCATTAGATTTTGAAGATATATGACTCCTTTGGGCTACATTTCATATTGATCAATTTCTAGGTATTTTTCACTGGCCCAAAGTATTGCATTCCCTTAACAGCAAGCACAAGTTCTCTATATCACTTGTTTTTTGTTGTTGTTGTTGTT