Transcript asmbl_101071

Sequence
Transcript Sequence for observation asmbl_101071 of TGE0057092:
TGCGTTTTACATGATCAGGTATTTATTGAGAAGTAAAATTTAGGAGGGTGTGGGACTGGTCTGAACTGATGCCAGACTGGTAGCTCAGGGGTACAGTGGAGAGTTGGAGAAGGGGTGACTGGGAGAGGAAGGACCCTCTGGGGAGATGACTCAGGGAGGCTGTGAGCCTCCTCCCTTGGGTGATTTTCACACTGGGTGCAGAATTCCCTGTACCCCACACTGAGAACCCCGGGGAGGCTAGCAATTTATGTGAGAAAAAAAATGAGATAAAACAAGATTTCTGGTTGTCAATGAGGATATTTATTGGGGTTTCATGAGTGCAGGGAGAAGGGCTGGATGACTTGGGATGGGGAGAGAGACCCCTCCCCTGGGATCCTGCAGCTCCAGGCTCCCGTGGGTGGGGTTAGAGTTGGGAACCTATGAACATTCTGTAGGGGCCACTGTCTTCTCCACGGTGCTCCCTTCATGCGTGACCTGGCAGCTGTAGCTTCTGTGGGACTTCCACTGCTCGGGCGTCAGGCTCAGGTAGCTGCTGGCCGCGTACTTGTTGTTGCTCTGTTTGGAGGGTTTGGTGGTCTCCACTCCCGCCTTGACGGGGCTGCCATCTGCCTTCCAGGCCACTGTCACAGCTCCCGGGTAGAAGTCACTGATCAGACACACTAGTGTGGCCTTGTTGGCTTGGAGCTCCTCAGAGGAGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACC