Transcript asmbl_95537

Sequence
Transcript Sequence for observation asmbl_95537 of TGE0003191:
GGAACTGCAGCGCTTAGAGAGCTCGGTGGAAGCTGCTAAAGGCGGAGGCGGGGCTCTGGCGAGTTCTCCTTCCACCTTCCCCCACCCTTCTCTGCCAACCGCTGTTTCAGCCCCTAGCTGGATTCCAGCCATTGCTGCAGCTGCTCCACAGCCCTTTTCAGGACCCAAACAACCGCAGCCGCTGTTCCCAGGATGGTGATCCGTGTATATATTGCATCTTCCTCTGGCTCTACAGCGATTAAGAAGAAACAACAAGATGTGCTTGGTTTCCTAGAAGCCAACAAAATAGGATTTGAAGAAAAAGATATTGCAGCCAATGAAGAGAATCGGAAGTGGATGAGAGAAAATGTACCTGAAAATAGTCGACCAGCCACAGGTTACCCCCTGCCACCTCAGATTTTCAATGAAAGCCAGTATCGCGGGGACTATGATGCCTTCTTTGAAGCCAGAGAAAATAATGCAGTGTATGCCTTCTTAGGCTTGACAGCCCCACCTGGTTCAAAGGAAGCAGAAGTGCAAGCAAAGCAGCAAGCATGAACCTTAAGCACTGTGCTTTAAGCATCCTGAAAAATGAGTCTCCATTGCTTTTATAAAATAGCAGAATTAGCTTTGCTTCAAAAGAAATAGGCTTAATGTTGAAATAATAGATTAGTTGGGTTTTCACATGCAAACATTCAAAATGAATACAAAATTAAAATTTGAACATTATGGTGATTATGGTGAGGAGAATGGGATATTAACATAAAATTATATTAATAAGTAGATATCGTAGAAATAGTGTTGTTACCTGCCAAGCCATCCTGTATACACCAATGATTTTACAAAGAAAACACCCTTCCCTCCTTCTGCCATTACTATGGCAACTTAAGTGTATCTGCAGCTCTACATTAAAAAGGAGAAAGAGAAATAACCTGTCTCTCATTCCTAAGTTGCCTCATTAATTTTCATGAACAAGAATATGTACCTTTTTGATGCTATATTACTGCGATTAAAAAGTTCTTGCAGGTAATGTTTATGATATGTTAAACGTTGTAATTTCCTATCGTAATTATAACATTCCCATTCTTTTGTAGATGAAACTTCTACATATTGAACCACAGATTTTCTGAGCTTCTAAATGTAGCCTTTCATTGCACATTTCAGTGATCAGAATAGATATCCTTTTACACGCACAAAAGCAATAGATTCATTCAGTGGACAAGTTCCTTGTTTAACTACACAGCTATGATGGAATGATATATCCAAGTTCCTTGCCTCAGTGAAATATGCATATGTATATCATGAAAGTGGGATGCCAAGTAAGCTTAAAATGGCATTCTCTAGCAAAGAGATTAGACTTTTAAATAACTCTTATAAAACAGGTTGGCGATCATTTCCCAAGATTGGTTTCCCTTGAGTTTTTGCTAAAACAAATCTTAGTAGTTTTGCCCGTTTAAAACAACTCACAATCGTAAATGCTACTATTCCTAAGATATCTTACCTTTTTATTTCAGTTTAGCCATGTATTGTATGAGTGTATTAGTCTAAGCAGTGAGAATCTTTTCTATGCCTCTATTCCAGCAAAAAGTAGAAGTATCAAATAAAAAGGGCAACTTTTAAAATATTAAGCCTGAAGACTTCTAAAAAGACAAGAAACATGGCCTAAATAACCAACATAGATTTACATAGTAAGTTTCACACTACCTTATTACCAAAAGCAAACACCTCTTACTTTAAACTACATTATCATGTATATCTATTGTATGCTGGTCTTTACTTTTTGCCAAAATCAACATATAATGAAGAGATGCCTTTGTTTCATGAGATTCAAACTTGATGCTATGCTTTAAAATAAACTCAGTACTTTTAGAAACATAA