Transcript asmbl_93176

Sequence
Transcript Sequence for observation asmbl_93176 of TGE0056984:
ACTGGGAACCCGGCTGGGGTTGGAGGAGGTGGGGCCTGAGTGTGGGTATTGGACCCAGGGCTGGCACAGATAGCCCTGCCTGGCACTCACTCTTCACTTTGAGGTCACAGGGCCACCCAGGCTGTTCGTGGGAGGTGGGAGGCCCAAAGGCTGATGAGCCGGTCTTACACTCTTTCCCTGCCCAGGTGACTACGAAGTCTCAGTCAAGTTCAACGAGGAACACATTCCCGACAGCCCCTTCGTGGTGCCTGTGGCTTCTCCGTCTGGCGACGCCCGCCGCCTCACTGTTTCTAGCCTTCAGGTGAGGCACCGAGAGAAACCGCCCACCTGGGGCTCCTGGGCCCGGACAGACCAGAGCCACCGCAGAGACCAGGCCTTGGCCCTGTGTTCAGTGACCCCCCTGGCCCAGCTCTGGGTTCCAGGCCTCTGCTCTGGCCGGGTGCAGCCCACGCTTGGGGTCGGCAGGAAATATCCTGCCCACCACGTGGAGTTTTTCTCGTGTCTCAGGTCTAAAGGCTTTGAACAGAAGCCTGTGCCCCTTGAGCACCAGGGCTGCGGTTTAAAGAGGGACAGCCTGCCAAGGCTGGGTGCTGCCCACAGGGTGGGGCAGCCCTCCCTTCCTGCCACCTGGGTGTGTGCGACGGCAGAGTGTGGGGGCAGGGGCGGGGATGTGCGCCTGTGGCTTGCTGCCCCTTGCAAATCAGTGGCTCTCCCTCTTTAAACCAAGTTGGACGCCAGATGGGTAAGTGCGACCCGCGGGCCTCTTGCTCCTGGGGCCTTTCCGTCCTCCCTTGCCCTGGCTCAAGCACCCCCATCTAACCATGTCTGCTGTGCTTCCAGGAGTCAGGGCTAAAGGTCAACCAGCCAGCCTCTTTTGCAGTCAGCCTGAACGGGGCCAAGGGGGCGATCGATGCCAAGGTGCACAGCCCCTCAGGAGCCCTGGAGGAGTGCTATGTCACAGAAATTGACCAAGGTGAGGCCCTGTCCCTGCCCGGCCGCCCTGCCCTGCTGGCTGGAAGCAGGCTGAGAGTACAAAAGGAAGGTACCGCTTCTGTAAGCAGCCAAGACGGGGCCCCAACTCCTGGGCCCCCTAAGCCAGGCAACCCTTTCCCAATTGGTGACCCAAGCCGCTGGGGATGTGGCTCGCCACCCACAGCTATTAGGAAGGCCTTCTACCCTGCAGTACCATGCCATCTCCACAGGGAAAGACTCAAAGTCCAGCCTCAGTGCTGCCCGGCCCTTCAGCCACGGCCATGGTACTTGTGCACAGGCCTGGGGCAGCCTTGTGGGTAGGAGGAGCCCAGTGGGCTTCATTTCACGGCCTAGTCCTGCCCTTCCCAGCTGCATGACCTGAAGCAAGTTCCTGCCCGTCTCTGAGCCTGTTAACATGCAGGGGATATGGTGTTCACGGTAACCTTTCTTAGGAGGCAGCAAGGCCTGGGTTTGGCTTGTAAAAGATTTCCGTCCCAATGCACCCTGACGGTGGGCAGCTTGAGTGTCTAAACCTTCGGCCCTCAGGAGGTCTGCTGCGGGGTGCAGGTGCCCAGCGTGGCTGGGCTCACACTGATGGACCGGCAAAATGGGGAGGGCCAGGGTTGAGGCTGTTCCTCACAGACACCATCTGCTGGTTTGAGGAGGGGCCCCAGGCCCACAGCATGACTCCCTGCTCCTCAGATAAGTATGCTGTGCGCTTCATCCCTCGGGAGAATGGCGTTTACCTGATTGACGTCAAGTTCAACGGCACCCACATCCCTGGAAGCCCCTTCAAGATCCGAGTTGGGGAGCCTGGGCATGGAGGGGACCCAGGCTTGGTGTCTGCTTACGGAGCAGGTCTGGAAGGCGGTGTCACAGGGAACCCAGCTGAGTTCGTCGTGAACACGAGCAATGCGGGAGCTGGTGCCCTGTCGGTGACCATTGACGGCCCCTCCAAGGTGAAGATGGATTGCCAGGAGTGCCCTGAGGGCTACCGCGTCACCTATACCCCCATGGCACCTGGCAGCTACCTCATCTCCATCAAGTACGGCGGCCCCTACCACATTGGGGGCAGCCCCTTCAAGGCCAAAGTCACAGGCCCCCGTCTCGTCAGCAACCACAGCCTCCACGAGACATCATCAGTGTTTGTAGACTCTCTGACCAAGGCCACCTGTGCCCCCCAGCATGGGGCCCCGGGTCCTGGGCCTGCTGACGCCAGCAAGGTGGTGGCCAAGGGCCTGGGGCTGAGCAAGGCCTACGTAGGCCAGAAGAGCAGCTTCACAGTAGACTGCAGCAAAGCAGGCAACAACATGCTGCTGGTGGGGGTTCATGGCCCAAGGACCCCCTGCGAGGAGATCCTGGTGAAGCACGTGGGCAGCCGGCTCTACAGCGTGTCCTACCTGCTCAAGGACAAGGGGGAGTACACACTGGTGGTCAAATGGGGGGACGAGCACATCCCAGGCAGCCCCTACCGCGTTGTGGTGCCCTGAGTCTGGGGCCCGTGCCAGCCGGCAGCCCCCAAGCCTGCCCCGCTACCCAAGCAGCCCCGCCCTCTTCCCCTCAACCCCGGCCCAGGCCGCCCTGGCCGCCCGCCTGTCACTGCAGCCGCCCCTGCCCTGTGCCGTGCTGCGCTCACCTGCCTCCCCAGCCAGCCGCTGACCTCTCGGCTTTCACTTGGGCAGAGGGAGCCATTTGGTGGCGCTGCTTGTCTTCTTTGGTTCTGGGAGGGGTGAGGGATGGGGGTCCTGTACACAACCACCCACTAGTTCTCTTCTCCAGCCAAGAGGAATAAAGTTTTGCTTCCATTC