Transcript asmbl_85366

Sequence
Transcript Sequence for observation asmbl_85366 of TGE0056079:
CCTGAAAACTGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAAGCCAAGGGACGTTGACCTGGACTGAAGTTCGCATTGAACTCTACAACATTCTGTGGGATATATTGTTCAAAAAGATATTGTTGTTTTCCATGATTTAGCAAGCAACTAATTTTCTCCCAAGCTGATTTTATTCAATATGGTTACGTTGGTTAAATAAACTTTTTTTAGATTTAGAAGGTGATGTAATGATGT