Transcript asmbl_85289

Sequence
Transcript Sequence for observation asmbl_85289 of TGE0002736:
TTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTCCTGACTCACCGCTGTTCGCTCTCGCCGAGGAACAAGTCGGTCAGGAAGCCCGCGCGCAACAGCCATGGCTTTTAAGGATACCGGAAAAACACCCGTGGAGCCGGAGGTGGCAATTCACCGAATTCGAATCACCCTAACAAGCCGCAACGTAAAATCCTTGGAAAAGGTGTGTGCTGACTTGATAAGAGGCGCAAAAGAAAAGAATCTCAAAGTGAAAGGACCAGTTCGAATGCCTACCAAGACTTTGAGAATCACTACAAGAAAAACTCCTTGTGGTGAAGGTTCTAAGACGTGGGATCGTTTCCAGATGAGAATTCACAAGCGACTCATTGACTTGCACAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTGGAAGTCACCATTGCAGATGCTTAAGTCAACTATTTTAATAAATTGATGACCAGTTGTTAA