Transcript asmbl_80758

Sequence
Transcript Sequence for observation asmbl_80758 of TGE0056962:
TGGTCCTGCTGGTCCCGCCGGTCCCCGTGGTGAAGTGGGTCTTCCAGGCCTCTCCGGCCCCGTTGGACCTCCTGGTAATCCTGGAGCAAACGGCCTTACTGGTGCCAAGGGTGCTGCTGGCCTTCCCGGCGTTGCTGGGGCTCCCGGCCTCCCTGGACCCCGCGGTATTCCTGGCCCTGTTGGTGCTGCCGGTGCTACTGGTGCCAGAGGACTTGTTGGTGAGCCTGGTCCAGCTGGCTCCAAAGGAGAGAGCGGTAACAAGGGTGAGCCCGGCTCTGCTGGGCCCCAAGGTCCTCCTGGTCCCAGTGGTGAAGAAGGAAAGAGAGGCCCTAATGGGGAAGCTGGATCTGCCGGCCCTCCAGGACCTCCTGGGCTGAGAGGTAGTCCTGGTTCTCGTGGTCTTCCTGGAGCTGATGGCAGAGCTGGCGTCATGGGCCCTCCTGGTAGTCGTGGTGCAAGTGGCCCTGCTGGAGTCCGAGGACCTAATGGAGATGCTGGTCGCCCTGGGGAGCCTGGTCTCATGGGACCCAGAGGTCTTCCTGGTTCCCCTGGAAATATCGGCCCCGCTGGAAAAGAAGGTCCTGTCGGCCTCCCTGGCATCGACGGCAGGCCTGGCCCAATTGGCCCAGCTGGAGCAAGAGGAGAGCCTGGCAACATTGGATTCCCTGGACCCAAAGGCCCCACTGGTGATCCTGGCAAAAACGGTGATAAAGGTCATGCTGGTCTTGCTGGTGCTCGGGGTGCTCCAGGTCCTGATGGAAACAATGGTGCTCAGGGACCTCCTGGACCACAGGGTGTTCAAGGTGGAAAAGGTGAACAGGGTCCCCCTGGTCCTCCAGGCTTCCAGGGTCTGCCTGGCCCCTCAGGTCCCGCTGGTGAAGTTGGCAAACCAGGAGAAAGGGGTCTCCATGGTGAGTTTGGTCTCCCTGGTCCTGCTGGTCCAAGAGGGGAACGCGGTCCCCCAGGTGAGAGTGGTGCTGCCGGTCCTACTGGTCCTATTGGAAGCCGAGGTCCTTCTGGACCCCCAGGGCCTGATGGAAACAAGGGTGAACCTGGTGTGGTTGGTGCTGTGGGCACTGCTGGTCCATCTGGTCCTAGTGGACTCCCAGGAGAGAGGGGTGCTGCTGGCATACCTGGAGGCAAGGGAGAAAAGGGTGAACCTGGTCTCAGAGGTGAAATTGGTAACCCTGGCAGAGATGGTGCTCGTGGTGCTCCTGGTGCTGTAGGTGCCCCTGGTCCTGCTGGAGCCACAGGTGACCGGGGCGAAGCTGGGGCTGCTGGTCCTGCTGGTCCTGCTGGTCCTCGGGGAAGCCCTGGTGAACGTGGTGAGGTCGGTCCTGCTGGCCCCAATGGATTTGCTGGTCCTGCTGGTGCTGCTGGTCAACCTGGTGCTAAAGGAGAAAGAGGAGCCAAAGGGCCTAAGGGTGAAAACGGTGTTGTTGGTCCCACAGGCCCCGTTGGAGCTGCTGGCCCAGCTGGTCCAAATGGTCCCCCCGGTCCTGCTGGAAGTCGTGGTGATGGAGGCCCCCCTGGTATGACTGGTTTCCCTGGTGCTGCTGGACGGACTGGTCCCCCAGGACCCTCTGGTATTTCTGGCCCTCCTGGTCCCCCTGGTCCTGCTGGGAAAGAAGGGCTTCGTGGTCCTCGTGGTGACCAAGGTCCAGTTGGCCGAACTGGAGAAGTAGGTGCAGTTGGTCCCCCTGGCTTCGCTGGTGAGAAGGGTCCCTCTGGAGAGGCTGGTACTGCTGGACCTCCTGGCACTCCAGGTCCTCAGGGTCTTCTTGGTGCTCCTGGTATTCTGGGTCTCCCTGGCTCGAGAGGTGAACGTGGTCTACCAGGTGTTGCTGGTGCTGTGGGTGAACCTGGTCCTCTTGGCATTGCCGGCCCTCCTGGGGCCCGTGGTCCTCCTGGTGCTGTGGGTAGTCCTGGAGTCAACGGTGCTCCTGGTGAAGCTGGTCGTGATGGCAACCCTGGGAACGATGGTCCCCCAGGTCGCGATGGTCAACCCGGACACAAGGGAGAGCGCGGTTACCCTGGCAATATTGGTCCCGTTGGTGCTGCAGGTGCACCTGGTCCTCATGGCCCCGTGGGTCCTGCTGGCAAACATGGAAACCGTGGTGAAACTGGTCCTTCTGGTCCTGTTGGTCCTGCTGGTGCTGTTGGCCCAAGAGGTCCTAGTGGCCCACAAGGCATTCGTGGCGATAAGGGAGAGCCCGGTGAAAAGGGGCCCAGAGGTCTTCCTGGCTTAAAGGGACACAATGGATTGCAAGGTCTGCCTGGTATCGCTGGTCACCATGGTGATCAAGGTGCTCCTGGCTCCGTGGGTCCTGCTGGTCCTAGGGGCCCTGCTGGTCCTTCTGGCCCTGCTGGAAAAGATGGTCGCACTGGACATCCTGGTACAGTTGGACCTGCTGGCATTCGAGGCCCTCAGGGTCACCAAGGCCCTGCTGGCCCCCCTGGTCCCCCTGGCCCTCCTGGACCTCCAGGTGTAAGCGGTGGTGGTTATGACTTTGGTTACGATGGAGACTTCTACAGGGCTGACCAGCCTCGCTCAGCACCTTCTCTCAGACCCAAGGACTATGAAGTTGATGCTACTCTGAAGTCTCTCAACAACCAGATTGAGACCCTTCTTACTCCTGAAGGCTCTAGAAAGAACCCAGCTCGCACATGCCGTGACTTGAGACTCAGCCACCCAGAGTGGAGCAGTGGTTACTACTGGATTGACCCTAACCAAGGATGCACTATGGATGCTATCAAAGTATACTGTGATTTCTCTACTGGCGAAACCTGTATCCGGGCCCAACCTGAAAACATCCCAGCCAAGAACTGGTATAGGAGCTCCAAGGACAAGAAACACGTCTGGCTAGGAGAAACTATCAATGCTGGCAGCCAGTTTGAATATAATGTAGAAGGAGTGACTTCCAAGGAAATGGCTACCCAACTTGCCTTCATGCGCCTGCTGGCCAACTATGCCTCTCAGAACATCACCTACCACTGCAAG