Transcript asmbl_80670

Sequence
Transcript Sequence for observation asmbl_80670 of TGE0056699:
AGGCCCCAGAGAGCAGGCGCTGGGCAGTGTGGAGGTCGTTGGAGTCACTTCCCCGTCACCAGCTCCTGTGCCTGCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGCCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCACTTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCCGGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGACCTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGGTAGTTATTCCGGCTGGAGTCCCCAGAAAGCCAGGCATGACCCGGGACGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGCACTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCACAGCAGAAGTTTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGACCCTGGACATCGTCAGAGCCAACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCGAGTCAACGTCCCTGTCATTGGTGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCACTCACTGGGCGGATCCAGGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCCACCCTCTCCATGGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAGGTGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACCGCTGCTGCTTGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTTTGAGGAGAAGATGATCTCGGATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGAAGATTTCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTATGAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGGTGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCATCAATAAAAGCCGTCCTTGATTTTATTTTTCAAGGTCCCTTCTGTAAATGCTGTGCTTTCTTCCCTGTGAGAGCCAACTTTAGAGTGTCTGCTACCTCTTCATTACCAATCAGAATTAGATGATGTTTAACTGTTAGACTGAAGCGTGACGCTTTCATCAGTAGCTTCAAGAAAGTCTAAATTGTTAATTTATGGAATTGGACACAGTATTCAGTTTACCCGTACATGCTCCTCCCGCCCCTCCTGTTGGCACCCTTGCATCGCCCAGGCCTGATTCCTCCTGGGGGTAGTTCACCCCCACGGGTTCATAGTTCAGCGGCGAATGCCAGGCAGCTGTTTTCTGGCTGAGCAAACAGCACCTTTCTCATTGAGCTTCCTCTACTGACCTCTGTCCCCCTTGGGATTTCATCTTCTGACCGAACCCTGATGTTCAGTGGCAGAGACAGCCCATAGCCAGAACTGTGGGTAGACCAGGGTTGGGGTGTGCGGTTTGGGACAGCCCAAACCCCAGCCGCTGTGTCAAGGCCTAGGACGCCATGCTGCCATCAAAAGGGGGTTCCAGGTTTCCATCAGTGGCCTAAAGAAGGGACTTCTTGTTGTACTGAGGAGTGCGGAATTAAAGAGATTTGACTCCCTTTAGTATTGGGGGCAGTCCGTTCCCCAGACACTGTGGCCTCTGAAGTGGAAACTGAAAGCTGCATACCTGGGAAAGAACTTTCTAGGAATAGGCAATGGCCTTCAGTGGAAGAGGGAGGGCTGGAGGTGTGCCCAGTACTTGGATGTTCATCTGTCCACAACAGCTTTTTGTTTTTTTAAAAAAGCTAAAATGGAAATGGATTTTATCATAAAGGATGACATCGTTTTCTTCTACAATTAATACATGTTCATTGTATAAAACCCAAAAAGCAGCTAAAAAATAAAGCGGGAAAGGAACTAC