Transcript asmbl_31480

Sequence
Transcript Sequence for observation asmbl_31480 of TGE0002767:
CAGGAGAAGAAACTAAGACCTGGAGTTTGAGTAATTCTTTCAAAGCTACCGAGTTGATAGAGGGACGAGAACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATATAGAGGAGCTGGCCATGAAATACGAGAGGCAATCCAGCATCCCGCAGACGAGAAGTTACAGGAGAAAGCATGGGGCGCGGTCGTTCCGCTCGTAGGCAAATTAAAGAAATTCTATGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTCCTGGGAGCCCTGACAAGTACCCCGTATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTACAGAAGAACGTTGAGTCGCATGAGGATTAATAATGTTCCAGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACCCCAATGCTGAAAACCTTAAGTGATGCCACCACAAAGTTTGTATCAGAGAATAAAAATTTACCAATAGAAAACACCACAGATTGTCTAAGCACCATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTCACAAATGAAGAGACGGTGTCATTCTGCTTGAGGGTTATGGTGGGCGTCATAATACTCTATGACCACGTACACCCCGTGGGAGCGTTTGCCAAAACTTCAAAAATCGACATGAAAGGTTGTATCAAGGTTCTTAAGGACCAGCCTCCTAATAGTGTAGAAGGTCTTCTCAACGCCCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATGACACTTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAGTGACTGAGAATGCACAGTTTTTTAGTGATTGCAATTACTATCTCATTTACTCTTGCTTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTATACTCTGAAGGGATATTGTCCTTTCAAACAGGCCGTCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAGAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCTTTTTTCATGTGCAGCCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAACCTTTTTTTAAATTAGTAAGACTTTTGTTTAAAGTTTTAAGTTTGCATTTTCACTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAACTGTGATGTGTGCGTAGAGTATTACGTATGCATGTTCATGTTTAAAGAATGGCTGTTGATAAAATAAAAATCAGCTTTCATTTTTCTA