Transcript asmbl_80425

Sequence
Transcript Sequence for observation asmbl_80425 of TGE0002528:
GTTTGCAAGAGGTGATTCTTTTTTCAAAGTGTCACGAAACGGGGTTGAAGCATCTTAAGTTTTTTCCTTTTGTTATTTAATTACCGATTGGAAAGAGGGAGGGTTTCTGAGCAGAAACCAAGTTGGGATTGCAGAACAGAGAAGATTCACAGTGCTTTACCGTTTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTGAGACAGAGTCTCGCTCTGTCGC