Transcript asmbl_80424

Sequence
Transcript Sequence for observation asmbl_80424 of TGE0002528:
GGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTGAGACAGAGTCTCGCTCTGTCGC