Transcript asmbl_80423

Sequence
Transcript Sequence for observation asmbl_80423 of TGE0002528:
CCCGAATCAACTTCTAGTCAAATTATTGTTCACGCCGCAATGACCCACCCCTGGCCCGCGTCTGTGGAACTGACCCCTGGTGTACAGGAGAGTTCGCTGCTGAAAGTGGTCCCAAAGGGGTACTAGTTTTTAAGCTCCCAACTCCCCCTCCCCCAGCGTCTGGAGGATTCCACACCCTCGCACCGCAGGGGCGAGGAAGTGGGCGGAGTCCGGTTTTGGCGCCAGCCGCTGAGGCTGCCAAGCAGAAAAGCCACCGCTGAGGAGACTCCGGTCACTGTCCTCGCCCCGCCTCCCCCTTCCCTCCCCTTGGGGACCACCGGGCGCCACGCCGCGAACGTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTGAGACAGAGTCTCGCTCTGTCGC