Transcript asmbl_78582

Sequence
Transcript Sequence for observation asmbl_78582 of TGE0003604:
GCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTATCCGCGTTCATCCGCGCCTTCAGGTGCCCCGCCGAGGGTTCGGATCCTGTAGGCCGCGCCGCGGACCCTTGCGCCACCTGCGCCGCGGGGCATTTCTCAAGGCGGGTCGGCCTGCGGGTCGCCCTTCCTACCAGGTCCGATCACTGAGAGCCTCCCTCTTCCACCGGGGCTTGGGTCTGGGTCTGAGCTCCCGTCGCTCTACTTGGTGTCCGGAATCTACGGGGGAGTCCGCCGTGGGCCGCCCGCCCGTCTCGAAGCCTAGACCTCGGAGGCTTCCAGGCAGTCCGAGCGTGTGGACTCCGCGGCCCTGAGCGCCCTGTCGCTTCTCTCCCGCAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGTTGGCACCGTTCTGATCCCACCCAGCCCTCAGTGCCCCCGTGCTTGCCCCTCCCCTGCAGGCTCCCGCTGAGCCGGAGGCGGGCACGTCGGTACTGATGTGCTAGGGTAGTTCAGACCCCCTGCTCCGGGCAGGCGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACATGAGGGGAGGCGTGGGTAGGCCTCGGCCGAGCCCGCCGGCCAGCCTGAGAAGCCAGGCTGGCTGCTGGTGAATGTGAACGCTCCGGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAGTT