Transcript asmbl_78581

Sequence
Transcript Sequence for observation asmbl_78581 of TGE0003604:
GCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTATCCGCGTTCATCCGCGCCTTCAGGTGCCCCGCCGAGGGTTCGGATCCTGTAGGCCGCGCCGCGGACCCTTGCGCCACCTGCGCCGCGGGGCATTTCTCAAGGCGGGTCGGCCTGCGGGTCGCCCTTCCTACCAGGTCCGATCACTGAGAGCCTCCCTCTTCCACCGGGGCTTGGGTCTGGGTCTGAGCTCCCGTCGCTCTACTTGGTGTCCGGAATCTACGGGGGAGTCCGCCGTGGGCCGCCCGCCCGTCTCGAAGCCTAGACCTCGGAGGCTTCCAGGCAGTCCGAGCGTGTGGACTCCGCGGCCCTGAGCGCCCTGTCGCTTCTCTCCCGCAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGTTGGCACCGTTCTGATCCCACCCAGCCCTCAGTGCCCCCGTGCTTGCCCCTCCCCTGCAGGCTCCCGCTGAGCCGGAGGCGGGCACGTCGGTACTGATGTGCTAGGGTAGTTCAGACCCCCTGCTCCGGGCAGGCGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACATGAGGGGAGGCGTGGGTAGGCCTCGGCCGAGCCCGCCGGCCAGCCTGAGAAGCCAGGCTGGCTGCTGGTGAATGTGAACGCTCCGGGTAAGGCTCGGTGGCTGCTGCGGTCCCAGACCCTTCACCGGCCCTTGGGACCCAGGGCTAGGCGTAACCTGTTGGTGCTGTCCCCCAAAACGCAGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAGTT