Transcript asmbl_78580

Sequence
Transcript Sequence for observation asmbl_78580 of TGE0002448:
GCCCACCCAACCGCTCTGCGGGTAGGACCGAGGAGCAAAGCATTATCGCGAGATCAGGGCCACTATTTGAGCGCATGCGCAAGACATGCTAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAGTT