Transcript asmbl_74538

Sequence
Transcript Sequence for observation asmbl_74538 of TGE0060594:
GTGAGGAATACCTTCACATAACTGAGCCTCCCTCTTTATCTCCTGACACAAAATTAGAACCTTCAGAAGATGATGGTAAACCTGAGTTATTAGAAGAAATGGAAGCTTCTCCCACAGAACTTATTGCTGTGGAAGGAACTGAGATTCTCCAAGATTTCCAAAACAAAACCGATGGTCAAGTTTCTGGAGAAGCAATCAAGATGTTTCCCACCATTAAAACACCTGAGGCTGGAACTGTTATTACAACTGCCGATGAAATTGAATTAGAAGGTGCTACACAGTGGCCACACTCTACTTCTGCTTCTGCCACCTATGGGGTCGAGGCAGGTGTGGTGCCTTGGCTAAGTCCACAGACTTCTGAGAGGCCCACGCTTTCTTCTTCTCCAGAAATAAACCCTGAAACTCAAGCAGCTTTAATCAGAGGGCAGGATTCCACGATAGCAGCATCAGAACAGCAAGTGGCAGCGAGAATTCTTGATTCCAATGATCAGGCAACAGTAAACCCTGTGGAATTTAATACTGAGGTTGCAACACCACCATTTTCCCTTCTGGAGACTTCTAATGAAACAGATTTCCTGATTGGCATTAATGAAGAGTCAGTGGAAGGCACGGCAATCTATTTACCAGGACCTGATCGCTGCAAAATGAACCCGTGCCTTAACGGAGGCACCTGTTATCCTACTGAAACTTCCTACGTATGCACCTGTGTGCCAGGATACAGCGGAGACCAGTGTGAACTTGATTTTGATGAATGTCACTCTAATCCCTGTCGTAATGGAGCCACTTGTGTTGATGGTTTTAACACATTCAGGTGCCTCTGCCTTCCAAGTTATGTTGGTGCACTTTGTGAGCAAGATACCGAGACATGTGACTATGGCTGGCACAAATTCCAAGGGCAGTGCTACAAATACTTTGCCCATCGACGCACATGGGATGCAGCTGAACGGGAATGCCGTCTGCAGGGTGCCCATCTCACAAGCATCCTGTCTCACGAAGAACAAATGTTTGTTAATCGTGTGGGCCATGATTATCAGTGGATAGGCCTCAATGACAAGATGTTTGAGCATGACTTCCGTTGGACTGATGGCAGCACACTGCAATACGAGAATTGGAGACCCAACCAGCCAGACAGCTTCTTTTCTGCTGGAGAAGACTGTGTTGTAATCATTTGGCATGAGAATGGCCAGTGGAATGATGTTCCCTGCAATTACCATCTCACCTATACGTGCAAGAAAGGAACAGTCGCTTGCGGCCAGCCCCCTGTTGTAGAAAATGCCAAGACCTTTGGAAAGATGAAACCTCGTTATGAAATCAACTCCCTGATTAGATACCACTGCAAAGATGGTTTCATTCAACGTCACCTTCCAACTATCCGGTGCTTAGGAAATGGAAGATGGGCTATACCTAAAATTACCTGCATGAACCGTAAGTGGTCCTTTAGAAAGAATGGACTACCGTGCTATAACAACTACTAGACACCTTCATTTTACGGCTGTGGTATCGGCAGTTTAGGGTATGGAGCAAGTAATATTGTGTGTTTTCTTTTTTTCTTTCTTTCCTTCCATGTAGCATCTGCATACCAAAGGACTTATTCTATGAAATACTTTAAAAATTCCTCATCAGCAAAGGACAATTCAATAAATACATCCAAACATGATCATCGTTGGAGCCGGAGGTGGCAGGAGTCGAGGCGCTGATCCCTAAAATGGCGAACATGTGTTTTCATCATTTCAGCCAAAGTCCTAACTTCCTGTGCCTTTCCTATCACCTCGAGAAGTAATTATCAGTTGGTTTGGATTTTTGGACCACCGTTCAGTCATTTTGGGTTGCCGTGCTCCCAAAACATTTTAAATGAAAGTATTGGCATTCAAAAAGACAGCAGACAAAATGAAAGAAAATGAGAGCAGAAAGTAAGCATTTCCAGCCTATCTAATTTCTTTAGTTTTCTATTTGCCTCCAGTGCAGTCCATTTCCTAATGTATACCAGCCTACTGTACTATTTAAAATGCTCAATTTCAGCACCGATGGCCATGTAAATAAGATGATTTAATGTTGATTTTAATCCTGTATATAAAATAAAAAGTCACAATGAGTTTGGGCATATTTAATGATGATTATGGAGCCTTAGAGGTCTTTAATCATTGGTTCGGCTGCTTTTATGTAGTTTAGGCTGGAAATGGTTTCACTTGCTCTTTGACTGTCAGCAAGACTGAAGATGGCTTTTCCTGGACAGCTAGAAAACACAAAATCTTGTAGGTCATTGCACCTATCTCAGCCATAGGTGCAGTTTGCTTCTACATGATGCTAAAGGCTGCGAATGGGATCCTGATGGAACTAAGGACTCCAATGTCGAACTCTTCTTTGCTGCATTCCTTTTTCTTCACTTACAAGAAAGGCCTGAATGGAGGACTTTTCTGTAACCAGGAACATTTTTTAGGGGTCAAAGTGCTAATAATTAACTCAACCAGGTCTACTTTTTAATGGCTTTCATAACACTAACTCATAAGGTTACCGATCAATGCATTTCATACGGATATAGACCTAGGGCTCTGGAGGGTGGGGGATTGTTAAAACACATGC