Transcript asmbl_7414

Sequence
Transcript Sequence for observation asmbl_7414 of TGE0002492:
AGGAGACCCCGCGCAGTGCTGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCAGATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACATCTCTCCAGAGCCCTTTCTGCACAGCTGGTGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAATTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCGTGTGAGACAAGGCCCATAGGTATGGCCCCCCCCTTCCCCCTCCCAGTACTAGTTAATTTTGAGTAATTGTATTGTCAGAAAAGTGATTAGTACTATTTTTTTTTGTTGTTTCAAAAAAAAAATTTTTGTGTGTGTGTGTTTTTTTTT