Transcript asmbl_70848

Sequence
Transcript Sequence for observation asmbl_70848 of TGE0056938:
ATTCACTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGGCGCGGGCGAGCCGGAGCAGAAGAAGGAGGGAGGGAGCCAGCCGCTGCAGCCACCACCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGTGGACATCACCCACTGGAATGACAGCGTCAAGCAGGAAGTGCAGAACCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTATATGGCTTATAAGGATTTGTATCAAGTATCTAACACAGAGCTCTATGAGATCTTCACCTGCCTGGGAGAGCTGGGGGCCATTGCTCAAGTTCATGCTGAGAATGGGGATATCATTGCCCAGGAGCAAACCCGCATGTTGGAAATGGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGGCCAGAAGAGCTGGAAGCTGAGGCTGTGTTCCGTGCCATCACCATTGCCAGCCAAACCAATTGCCCTCTCTACGTCACAAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAATGTAGTCTTTGGTGAGCCCATCACTGCCAGCCTCGGCATAGATGGAACCCATTATTGGAGCAAGAACTGGGCCAAGGCGGCTGCATTTGTGACATCCCCACCCCTGAGCCCTGACCCAACTACTCCGGACTACATCAACTCCTTGCTGGCCAGCGGGGATCTGCAGCTATCTGGGAGTGCCCACTGCACCTTCAGCACTGCCCAGAAAGCAATTGGGAAGGACAACTTCACAGCCATTCCTGAGGGCACCAATGGTGTGGAGGAGCGGATGTCTGTCATCTGGGACAAGGCTGTGGCCACAGGGAAAATGGACGAAAACCAGTTCGTGGCTGTGACAAGCACAAACGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGCGACCTCGTCATCTGGGATCCAGATGCTGTGAAGATCGTCTCTGCCAAGAACCACCAGTCTGCGGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGCGGGGCTCCTCTGGTTGTCATCTGCCAGGGCAAGATCATGCTGGAAGATGGCAACCTGCACGTGACCCAGGGGGCTGGCCGCTTCATACCCTGCAGCCCGTTCTCCGACTATGTCTACAAGCGCATTAAAGCACGGAGGAAGATGGCAGACCTGCATGCCGTCCCAAGGGGCATGTACGATGGGCCTGTGTTTGACCTGACCACCACCCCCAAAGGTGGCACCCCCGCAGGCTCTGCTCGGGGCTCTCCTACTCGGCCGAACCCACCTGTGAGGAATCTTCATCAGTCGGGATTTAGCCTGTCAGGCACCCAAGTGGATGAGGGGGTTCGCTCAGCCAGCAAGCGCATCGTGGCGCCCCCAGGCGGCCGTTCTAATATCACATCTCTGAGTTAAGCAAGCCTTCCTCAAAGAGAGGGGCAGAAGCAAGAAGAGATTGTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAATCCAAACGGTTGTGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAATATTGCTTTGTTTTCTGTTTATGCATAGCCTTGATTTGTTTGACTCCCCTCCCCCCATTTACATGCATGCAATCAGACAGGCCACTAAGGTAAAAGAGTCTGCTCTATCATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTATGACAAGGGGACAGACAAGCTGGGACGTCAGGGAAATGAACAAAAGGGACGCAGGTTATTTGGGGTGAGTGGGTGGTGGGAGCCTGGAGCAAGGTGGAGGGTGCAGAGGGGCTGGGGTAGGGCATGTAGGAGGGAGGTGGGTGGGTCAGGTGAGTGGAAGGGGTGTTGTATATTGTGTTGATGACGTACGTTATTTCCATGGAAGATAGCCGCTGTGGCAGCTGTCACATCACCACAGCTCCCTAGGGTCTGCCGAGAAGGCAGGCAGTCTTTGGGTTCTGTTCTTTGTCACGTCCCCTACAAGTAAATTTTGTTTCTTTGAACGTTTATTAAAATGCCAAGACCCAACCATTTCTTCCACCTGCTTGATTGTGCCAGTGTTTGCTCAGGCCTCTTTCTTAGTGTTGCTTTCAAATCCTTCTCTTTCCTGGGTTGGGAAGGCCAGGCAGGGACAGAGCAAATGACACTTCTCTTCCTCTTGCCCTCCCTGCCTCTTTGGTGCTCTTAAAAGCCAGCAGCTGAGAACATAGCACAGGCCCACGTGGTGAGGGCACCCACAGCTTAAAGACGCTTCCTTCTAAACACGGCGAGGTCACCTCTCACTCTTCTGTCTTTGCAAACCGAGAAGAGTGGCATGCTTCTGGCATCCCAAGTCAGGATTTTAGCTCAGATGAGGCAGAATGAAGGGCCTCTCTTACAGGCAGTTTGTGTTTGATTCTCTCGATCCTGGCACATCCATGATAAATAGGAGTTTTTGAAAGTTGGTTTTATTAGGTGTTCCCTAATTTTTACCGTAATAGGTCATCTCAGCTTATATGAAAGTCAAGTGGGGAACTGGGAAAGCCAAAGTCAGTCTTGAGCAGAGGGAGCACATTTTGTGGACCTGGTTCCACCTTTCCATTCCAAACCACCTGTTTCCCCTTCCATTAGCAGAAACTCTGGGGGAACTTTGTGTCTCAGTCCTAGAATCTCCCCAAGTGAGTGGAAGTGACATGATGCAGTCTTCCTCATGGGGCACCTGAAAGAAATTAGTGTGGGTGCTTCGATCTACCTTGTCTGTCAGAGTTGAATATCTCTTTCCCTATCATGCTGCTTCTGAAAATTCAGTTTTGGAGCAAGTCCTGTGAGCAAGATAAGAATCTATAGAACCAAGATGCTCATTTTCAGAAGAAATATGTTCAACCTGGGATCAGACTTCCATGCTCTGGGGAATCCAAGTGGTAGCACCTGTAACCCTGTGTACTAAGTGCTTTGAAGAGAAGAGCAGGCCTCAGACACCTTTTAATTGCTTAGGAGAAACCATTGTCTCTGACTGCAGGTTTGAATAAGTTGAAGACCAGAGAAAAGTACACACTGGGCTACAAAGGAATTTGGAGATAGCCAAGGAACAGGATTTCCCCTAGCAAGCTACCTTCTGTTCAAATCATGAAAAAAGACTATTTCCCCTTAGAATAGGGAAGCTTGCTATTTTAAAGCTCTTGTAGTGCTTTTCTTTTAAGGGAGATGTAGTAAAAGGGAAAATGTAGCTCTTAGTTTACACTTCAAAGATGTGGGGGTCTTTCAGAGAACTAAGAATAACAGTTTTATGTGCAGAGAGAGTTTGCCAGATCTGAAGCATATACCTCATTGACTAGGCTGTTACTTTGGGATAGGTTGCAGTACCAGCCACAGCCAGCAGATAGAGGAAAAGACACACATAAACTCGCTTCTGAGCGTCCACTTCTGCACTCTCTGCTCTGCTGTTACTCAGCCCCTGAGTCTGACTCATCTCTGCACAACCTCTCTGTGCCATGAAGATAAGTCTTCCATGGCCAAATCGGTCATCCGCACTGCCCTTGGGACTTCCGAAGTGAACCATTCCACCAGAACCTTTGATTCTGCACAAGATTTCCTTGCTCTGGGAACAACCCCCAAATGCCCTTGGGAGGAACAACATGAGCTCAGGAAGCCTCTCTTTCTTCACTTACCATTACTAACTCTCCAAGCATAGAAATCCCTGGGAATTGCGAGAATAACTCCCACTATTTTAAAATTTATATTCAGATTTGTTTCGTTTCATAAGACACATCAAACAGGCCTATACAAAAGGTTTAGGAAAAGAAAACAATGGTGAGTCCCGGCCCTCTTCGAATTCACTGGCACCTCATGCAAGTGTAGGAAGGCACGCTGGATCGTCTATCTGATTCCAAAGCTGTCCTTTGCCATCTCATCCCTTGGCCTGCCCCCCAACCCTGAGGATGCCCCTGCCATCCCCCCAACCTCCTCATATTGCCTCTGAACCCAGATGGCAATCCATCCCGGTTCTCTCTGAGGGCCACGGGCTTGGGTAGTGGAAAGGGTGTTTGGGAAATTGTTAAATCAGTTACCCGTAGTAGAGCTATTTCTTGTACTTCTAAGTTTTCTAGAAGTGGAAGGATTGTAGTCATCCTGAAAATGGGTTTACTTCAAAATCCCTCAGCCTTGTTCTTCACGACTGTCTATACTGAGAGTGTCATGTTTCCACAAAGGGCTGACACCTGAGCCTGGATTTTCACTCATCCCTGAGAAGCCCTTTCCAGTAGGGTGGGCAATTCCCAACTTCCTTGCCACAAGCTTCCCAGGCTTTCTCCCCTGGAAAACTCCAGCTTGAGTCCCAGATACACTCATGGGCTGCCCTGGGCAGCCAGCATTCATTGTAAGTTCCCTCTTTGAAAACTGGTGTGTGGGTGTTCAGTTCTGTGTCTGGTGGGTATGGACAGACAGTAATCTCCTGTGATCTGTGCTAGCTGTGAGGCAGCTCTGGAACGTGAAGAGCTGTTTGGTTTGAACCGTGAACAAAACTGTGTTTTGAGTTTAGCTGACATTAAAGAAAAAAGTTCATCACGTGACTGTTAATGTAAACCTGGTTATTAAAATAACTATGAAATTA