Transcript asmbl_3121

Sequence
Transcript Sequence for observation asmbl_3121 of TGE0004782:
CCGAGTTCCAACCGGTTCCTAATCTAGTTCCGCAGTCGTCCGCCTTTTCTTCCTTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTGGCTGCAGCCATCTCCAAGACGGCGGTAGCACCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAAATCACCGCAGATAAGCAGTACAAGGGCATTATAGACTGCGTGGTTCGTATCCCCAAGGAGCAGGGAGTACTATCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTCAACTTTGCCTTCAAAGATAAATACAAGCAGATCTTCCTAGGTGGTGTGGACAAGAGAACCCAGTTCTGGCGCTACTTTGCAGGCAATCTGGCATCAGGTGGTGCCGCTGGGGCCACCTCCTTGTGTTTTGTGTATCCTCTTGATTTTGCCCGTACCCGTCTAGCTGCTGATGTGGGCAAAGCTGGAGCTGAAAGGGAATTCAAAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAGGGGCCTGTACCAAGGCTTTAATGTGTCCGTGCAGGGTATTATCATCTACCGAGCTGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCAGACCCCAAGAATACTCACATCTTCATCAGCTGGATGATTGCACAGTCCGTCACTGCGGTGGCTGGGTTAACTTCCTATCCATTTGACACTGTTCGTCGTCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGATATCATGTACACGGGCACGCTCGACTGCTGGAGGAAGATTGCTCGTGATGAAGGAAGCAAAGCTTTTTTCAAGGGTGCATGGTCCAACGTTCTCAGAGGCATGGGTGGTGCTTTTGTGCTTCTCTTATATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAGTCTATTTTCCCCGTGAACAGGCATGTTGTGTTATGTAACATATCTTTGAGCATTCCTGACAGACTGTTGGCTATTTATCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCCGACCAGTTTTCTCCTAAAGCTATTTCCATGATGATCATGATAATGATGGGACTCAATTATATTTTTTATTTCAGTCACTCCTAATAATAAATTTGAAGAAATAAAAAGTATCTG