Transcript asmbl_6388

Sequence
Transcript Sequence for observation asmbl_6388 of TGE0060554:
GTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCGCCATGATGGGCCATCGTCCAGTGCTCGTGCTCAGCCAGAACACAAAGCGTGAATCCGGAAGAAAAGTTCAATCTGGAAACATCAATGCTGCCAAGACTATTGCAGATATCATCCGAACATGTTTGGGACCCAAGTCCATGATGAAGATGCTTTTGGACCCAATGGGAGGCATTGTGATGACCAATGATGGCAATGCCATTCTTCGAGAGATTCAAGTCCAGCATCCAGCGGCCAAGTCCATGATCGAAATTAGCCGGACCCAGGATGAAGAGGTTGGAGATGGGACCACATCAGTAATTATTCTTGCAGGGGAAATGCTGTCTGTAGCTGAGCACTTCCTGGAGCAGCAGATGCACCCAACAGTGGTGATCAGTGCTTACCGCAAGGCATTGGATGATATGATCAGCACCCTAAAGAAAATAAGTATCCCAGTCGACATCAGTGACAGTGATATGATGCTGAACATCATCAACAGCTCTATTACTACCAAAGCCATCAGTCGGTGGTCATCTTTGGCTTGCAACATTGCCCTGGATGCTGTCAAGATGGTACAGTTTGAGGAGAATGGTCGGAAAGAGATTGACATAAAAAAATATGCAAGAGTGGAAAAGATACCTGGAGGCATCATTGAAGACTCCTGTGTCTTGCGTGGAGTCATGATTAACAAGGATGTGACCCATCCACGTATGCGGCGCTATATCAAGAACCCTCGCATTGTGCTGCTGGATTCTTCTCTGGAATACAAGAAAGGAGAAAGCCAGACTGACATTGAGATTACACGAGAGGAGGACTTCACCCGAATTCTCCAGATGGAGGAAGAGTACATCCAGCAGCTCTGTGAGGACATTATCCAACTGAAGCCCGATGTGGTCATCACTGAAAAGGGCATCTCAGATTTAGCTCAGCACTACCTTATGCGGGCCAATATCACAGCCATCCGCAGAGTCCGGAAGACAGACAATAATCGCATTGCTAGAGCCTGTGGGGCCCGGATAGTCAGCCGACCAGAGGAACTGAGAGAAGATGATGTTGGAACAGGAGCAGGCCTGTTGGAAATCAAGAAAATTGGAGATGAATACTTTACTTTCATCACTGACTGCAAAGACCCCAAGGCCTGCACCATTCTCCTCCGGGGGGCTAGCAAAGAGATTCTCTCGGAAGTAGAACGCAACCTCCAGGATGCCATGCAAGTGTGTCGCAATGTTCTCCTGGACCCTCAGCTGGTGCCAGGGGGTGGGGCCTCCGAGATGGCTGTGGCCCATGCCTTGACAGAAAAATCCAAGGCCATGACTGGTGTGGAACAATGGCCATACAGGGCTGTTGCCCAGGCCCTAGAGGTCATTCCTCGTACCCTGATCCAGAACTGTGGGGCCAGCACCATCCGTCTACTTACCTCCCTTCGGGCCAAGCACACCCAGGAGAACTGTGAGACCTGGGGTGTAAATGGTGAGACGGGTACTTTGGTGGACATGAAGGAACTGGGCATATGGGAGCCATTGGCTGTGAAGCTGCAGACTTATAAGACAGCAGTGGAGACGGCAGTTCTGCTACTGCGAATTGATGACATCGTTTCAGGCCACAAAAAGAAAGGCGATGACCAGAGCCGGCAAGGCGGGGCTCCTGATGCTGGCCAGGAGTGAGTGCTAGGCAAGGCTACTTCAATGCACAGAACCAGCAGAGTCTCCCCTTTTCCTGAGCCAGAGTGCCAGGAACACTGTGGACGTCTTTGTTCAGAAGGGATCAGGTTGGGGGGCAGCCCCCAGTCCCTTTCTGTCCCAGCTCAGTTTTCCAAAAGACACTGACATGTAATTCTTCTCTATTGTAAGGTTTCCATTTAGTTTGCTTCCGATGATTAAATCTAAGTCATTTG