Transcript asmbl_63411

Sequence
Transcript Sequence for observation asmbl_63411 of TGE0007602:
CGCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCTCTCCTTCGTGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATTCAGCAGAGAGCTATTATTCCCTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCCACTTGTCATGCCTGCATTGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCCGGGAGAGTGTTTGATATGTTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGTGGTTTTAAGGATCAAATCTATGAGATTTTCCAAAAACTAAACACAAGTATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAGAGAGAGGAATGGAAGTTGGATACACTTTGTGACTTGTACGAGACACTGACCATTACACAGGCTGTTATTTTTCTCAATACGAGGCGCAAGGTGGACTGGCTGACTGAGAAGATGCATGCCAGAGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAGAGAGATGTTATCATGAGGGAATTCCGGTCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGCTCGCGGGATTGATGTGCAACAAGTGTCTTTGGTTATAAATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGAGTTTTGGATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTTGATAGCAAAGCGACGTTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAGTAGAAAGGCCTTTAAAATTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCCTAGGTAGGGTTTAATCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTT